1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetradugi [14.3K]
3 years ago
13

The second highest taxonomic classification between kingdom and class is called

Biology
2 answers:
____ [38]3 years ago
7 0

Answer:

Phylum

Explanation:

Taxonomy is the classification of living things based on their feature similarities

Phylum is the second highest taxonomical classification between kingdom and class

ivann1987 [24]3 years ago
6 0

Answer:

phylum

Explanation:

You might be interested in
The work done by dr. rose ann cattolico and her assistants at the university of washington involves _______.
sergeinik [125]
The question above is incomplete, the options attached to the question are as follows:
A. extracting chlorophyll from algae to learn how these organisms gain energy from light.
 B. engineering vehicles that use algae for fuel.
C. growing algae under different conditions and measuring their lipid production.
 D. engineering algae to photosynthesize at higher rates.

ANSWER
The correct option is C.
 Dr. Rose and her assistants set out to carry out scientific investigation that will identify living organisms that can grow rapidly and that will produce high quality lipids at the same time. The team had hypothesized that this type of organisms will be good candidates for production of bio fuels. The group concentrated on working with algae; these were grown under different conditions and their lipid contents were assessed. Their work has led to identification of many algae species as potential sources of bio fuel. <span /><span>
</span>
7 0
3 years ago
Read 2 more answers
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
I’m marking as brainliest! Answer the correct answer !
expeople1 [14]

Answer: B

Explanation: took the test 3 days ago and teacher went over the correct answer and i got it right hoped this helped :) PS: i think its the same test as mine is the second question . In humans, the first seven pairs of rib bones are connected to the sternum (breastbone) by cartilage. Which of the following statements describes the main reason why cartilage is important in these bone-to-bone connections?

5 0
3 years ago
-261.4°F<br>-164.3°C<br>what's the kelvin​
Sliva [168]

Answer:

it is the base unit of temperature .

Explanation:

you can change celisus into kelvin by doing a quick math .

K = °C + 273

6 0
3 years ago
Capital P represents purple lowercase p represents white. What color would a flower be if it was Pp?
Lady_Fox [76]

Answer:

It depends:

Complete Dominance: Purple only

Incomplete Dominance: A Magenta Type Color

Co-Dominance: Purple and White at the same time

7 0
3 years ago
Other questions:
  • People with achondroplastic dwarfism are heterozygous for a dominant allele conferring this trait. The homozygous dominant condi
    5·2 answers
  • Which of the following can result in irregularities leading to cancer?        A. The body using cyclins to regulate the timing o
    5·2 answers
  • In comparison to the first (or typical) antipsychotic medications that developed, the atypical antipsychotics:
    14·1 answer
  • Enzymes, which are proteins, play a crucial role in everyday life processes. Without enzymes, the digestion of food, such as car
    13·1 answer
  • Which is the broadest most inclusive category of life on Earth
    14·1 answer
  • which of the following is an example of parasitism? a. clownfish defending sea anemone from other predators b. hookworms consumi
    11·2 answers
  • 1. Which of the following is an example of a scientific theory?
    5·1 answer
  • Which structure has functions in both the respiratory system and the digestive system?
    6·1 answer
  • Why is the use of coal declining in the United States?
    13·1 answer
  • In mice, the allele for BROWN FUR (BB or Bb) is completely dominant over the allele for white fur (bb).
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!