All categories

2 years ago

Name the three hormones and how they affect the body

Biology

1 answer:

yaroslaw [1]2 years ago

7 0

ACTH (Adrenocorticotrophic hormone) stimulates the adrenal glands to secrete its hormones.

hGH (Human growth hormone) also known as somatotrophic hormone is responsible for the growth of long bones, muscles and viscera.

TSH (Thyroid stimulating hormone) influences the structure of the thyroid and causes it to secrete thyroid hormone.

You might be interested in

1. Name three types of evidence used to support the theory of evolution

Llana [10]

Answer:

1) Fossil evidence Support

2)Genetic evidence supports evolution.

Biological evidence supports evolution;

Explanations;

1)Fossil evidence Support evidence;

This gives the geographic information about many fossils, it gives evidence that two species with a common ancestor can have their development differently and in

different locations. The common ancestor term is crucial especially in

theory of natural selection . In this evidence there is prove that common ancestor is shared through comparison between modern plants and modern algae to fossil algae by scientist.

Examples are bones, exoskeletons, stone imprints of microbes as well as animals.

2)Genetic evidence supports evolution.

This provides the understanding of how traits are passed from one generation to another under the study of DNA, DNA which contains the information needed by all organisms need to grow and to maintain themselves.geneticmaterial are passed to offspring by parent during reproduction. There are code which is made up of different chemical sub unit known as base. posses by DNA that helps to to function properly.

represented by letter A, T, C, and G.

3)Biological evidence supports evolution;

In this evidence, details about how evolution can be observed within the physical structures of adult organisms. is provided. It is evidence that involves of structural evidence such as vestigial structure which means an organisms with organs and similar structures with different functions.

For Example, considering the bodies of whales which is an organisms,there are small leg bones that are vestigial.

5 0

2 years ago

"the competitive exclusion principle only applies when species differ in their competitive abilities"

timofeeve [1]

The natural selection process applies majorly inside back species wether than between species.

6 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

Practicing three-point shots to improve free-throw accuracy contradicts the _________ principle of exercise.

vodomira [7]

Practicing three point shots to improve free throw accuracy contradicts the SPECIFICITY principle of exercise.
The specificity principle of exercise states that, to become an expert in a particular exercise or skill one should perform that exercise or skill. That is, the things that one do during physical activity should be relevant to one desired outcomes, thus, the training regimen must go from general to specific during training.

5 0

2 years ago

Read 2 more answers

PLEASE HELP ME!!!!!! <br> What happens to the muscles when the weight is lowered?

erastovalidia [21]

Answer:

C is the answer to the question

6 0

2 years ago