1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NeTakaya
3 years ago
15

This is a star that is generating light and heat by the conversion of hydrogen to helium by nuclear fusion in its core.

Biology
1 answer:
dolphi86 [110]3 years ago
5 0
The correct answer is main sequence

You might be interested in
Elephants and rhinos tolerate the small birds that ride their backs and eat insects on their skin. the relationship between the
jarptica [38.1K]
This is called symbiosis.
6 0
3 years ago
Read 2 more answers
Match each moon or planet to the most accurate characteristic
Greeley [361]

Answer:

Which two details from the short story excerpt BEST support the correct answer above? A) "As if that could have anything to do with --with--My, wouldn't they laugh?" (section 1) "But you know juries when it comes to women. If B) there was some definite thing--something to show." (section 2) "No, Mrs. Peters doesn't need supervising. For that matter, a sheriff's wife is married to the law." (section 3) D) Then Martha Hale's eyes pointed the way to the basket in which was hidden the thing that would make certain the conviction of the other woman-- (section 4) Martha Hale snatched the box from the sheriff's wife, and got it in the pocket of her big coat just as the sheriff and the county attorney came back into the kitchen (section 5) E)

6 0
2 years ago
Thale cress is a plant that is genetically engineered with genes that break down toxic metals. Which type of organism is describ
Misha Larkins [42]

Any genetically engineered organisms is referred to as a transgenic organism.

A transgenic organism is any organism that was modified genetically or engineered by humans, for certain purposes, in this case, the function of the thale cress is to break down toxic metals in the water (cress plants grow on water).

Hope it helped,

Happy homework/ study/ exam!

3 0
3 years ago
What the type of solid materials are typically hard, have high melting pionts and poor electrical conductivities ?
kondaur [170]

Answer:

Ionic compounds

Explanation:

Ionic crystals are hard and brittle and have high melting points.

7 0
2 years ago
Are your body cells (e.g., red blood cells, muscle cells, or skin cells) eukaryotic or prokaryotic cells? Please support your an
elena-s [515]

Answer:

eukaryotic, because our body cells have nucleus and membrane-bound organelles

8 0
3 years ago
Other questions:
  • The mass of a single atom of carbon can be found by dividing the atomic mass (12.01 g) by 6.022 mc024-1.jpg 1023.
    14·2 answers
  • What is the symbol for carbohydrates
    6·1 answer
  • How can blood grouping be used in paternity testing
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • How does high water magma affect a volcano
    13·1 answer
  • Use the graph below to answer the following question: What is happening to the object's velocity
    5·1 answer
  • 10 points!! <br> Please help
    13·1 answer
  • How does an amoeba move?
    10·2 answers
  • Someone please help!!LEVELS OF ORGANIZATION Identify each of the following as:
    7·1 answer
  • Water can act as a blank or a blank
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!