1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrey2020 [161]
3 years ago
15

Ethylene is released fruit is ripening because of this Ethylene fruit nearby will also ripen what type of feedback is this

Biology
2 answers:
Ainat [17]3 years ago
5 0

Hi!


The answer would be B. Positive

Explanation:

A positive feedback mechanism is that in which a stimulus induces an output which in turn functions to magnify the same response <em>(acting as a stimulus to itself). </em>

As in this case, Ethylene acts as a stimulus for fruit ripening (<u>response</u>). When it is released during fruit ripening, it stimulates nearby fruits to ripen (<u>response</u>), which in turn acts to stimulate further fruits to ripen (<u>response</u>), resulting in the effect being widespread (<u>magnified</u>)


Hope this helps!

Rainbow [258]3 years ago
3 0

Answer: B Positive.

Explanation:

  1. Ethylene is the considered as the aging & growth for fruits.
  2. Infact, it produced by some fruits when ripening begins in them.
  3. It changes the texture & shape of the fruit during ripening process.
  4. For fruits ripening, it is used in positive nature. And, if nearby fruit are ripening as well, it is no longer a problem until the other fruit is damaged or dies. And, this does not happen if the concentration of ethylene is too much.
You might be interested in
I need help with this biology question pls and thankyou pls help
8090 [49]
The answer to this question is #2 it has guanine and ribose!
4 0
2 years ago
Please help if u can !
Olin [163]

Answer:

Hydrogen

Explanation:

I think it is showing cellulose cell or DNA as it is inverted 180° for the option there is no option for Phosphodiester bond however I know the answer is hydrogen.

5 0
2 years ago
A paragraph on the 3 forms of energy involved in a muscle contraction
irga5000 [103]
There are three types of energy involved in a muscle's contraction. There is metabolism, catabolism, and anabolism. Metabolism is the events that are carried out in the human body to create energy and other things needed for activity. Catabolism is the process during the organic matter is broken down and the energy is released, it takes place during increased movement. Anabolism is the energy-consuming process that substances are created, it takes place when there is little movement. All three of these work to gather in muscle contraction.  
7 0
3 years ago
Which type of fossil evidence helps determine the evolutionary relationship between two hominid species?
Triss [41]
The skull size of each species! 

It's the size of the skull specifically the jaw bones, that can help determine relationships of two hominid species.

Hope this helps!
8 0
3 years ago
Place the primers in the correct orientation and locations to amply this gene by pcr. if a primer does not belong in a particula
galina1969 [7]

DNA replication is the process of doubling a DNA double chain. In cells, DNA replication occurs before cell division. Prokaryotes continually replicate DNA. In eukaryotes, the timing of DNA replication is highly regulated, ie in the S phase of the cell cycle, before mitosis or meiosis I. The multiplication utilizes the DNA polymerase enzyme which helps form bonds between the nucleotides that make up the DNA polymer. The process of DNA replication can also be carried out in vitro in a process called a polymerase chain reaction (PCR).

<h2>Further Explanation </h2>

A slow strand (Lagging strand) is a DNA strand located on the opposite side of the leading strand on the replication fork. These strands are synthesized in segments called Okazaki fragments. In this string, primases form RNA primers. The DNA polymerase can thus use OH 3 'free groups in the RNA primer to synthesize DNA in the direction of 5' → 3 '. The primary RNA fragments are then removed (for example by RNase H and DNA Polymerase I) and new deoxyribonucleotides are added to fill the gaps that were previously occupied by RNA. DNA ligase then connects the Okazaki fragments so that the synthesis of lagging strands is complete.

Primers both on the steering strand and on the lagging strand will elongate with the help of Holoenzyme DNA polymerase III. This multisubunit complex is a dimer, half will work on the steering strand and the other half will work on lagging strands. Thus, the synthesis of the two strands will run at the same speed.

Each dimer part of the two strands consists of subunit a, which has the actual polymerase function, and subunit e, which has an editing function in the form of exonuclease 3'– 5 ’. In addition, there is a subunit b that attaches polymerase to DNA.

Once the primers in the remaining strand are removed by DNA polymerase III, they will be removed immediately and the gaps caused by the loss of the primer are filled with DNA polymerase I, which has 5 '- 3' polymerase activity, 5 '- 3' exonuclease, and editing 3 exonuclease '- 5'. Eksonuklease 5 '- 3' discard the primer, while the polymerase will fill the gap caused. Finally, the Okazaki fragments will be united by the DNA ligase enzyme. In vivo, the dimoenzyme DNA polymerase III and primosomes are believed to form large complexes called replisomes. With the replisom DNA synthesis will take place at 900 bp per second.

Learn more

DNA replication brainly.com/question/5932348

Details

Grade:  College

Subject:  Biology

keywords: DNA, RNA, replication.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Why are small rocks more susceptible to chemical weathering?
    6·1 answer
  • The cell's nucleus is filled with a substance called protein.
    5·2 answers
  • Synthetic compounds found in an organism but not normally produced or expected to be present in that organism are called _____.
    7·1 answer
  • What type of dominance is a blending of the two alleles to make a phenotype somewhere between the parent’s phenotypes? a incompl
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which best explains how the human body obtains energy from food?
    10·2 answers
  • Do cell walls manage the movement of all substances into and out of the cell?
    5·1 answer
  • In an Antarctic ecosystem, phytoplankton are eaten by krill, which are eaten by baleen whales. If the population of phytoplankto
    5·2 answers
  • How much has the greenhouse gas carbon dioxide increased in the air just in the last few years?.
    10·1 answer
  • A 7 Tesla scanner, or 7T scanner is preferable to a 3T scanner in what scenarios?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!