A scientific hypothesis is an educated guess that is made about an observation based on the prior knowledge of the scientist. Hypothesis are always testable.
An hypothesis can be tested through experimentation and it can also be tested through deductive methods.
Answer:
1. Support
2. Protection
3. Movement
4. Supply & Storage
Explanation:
1. Support : It provides a framework to support the organs and tissues of the body.
2. Protection: It protects our internal organs. The skull protects the brain; the thorax (sternum, ribs and spine) protects the heart, lungs and other viscera (organs within the thorax).
3. Movement: It provides a framework for muscles to attach. Then when the muscles contract they pull on the bones of the skeleton, which act like levers to create movement.
4. Supply & Storage: The bones that make up the skeleton are a source of both red blood cells (which transport oxygen) and white blood cells (which fight infection), which are formed within the bone marrow.
Answer: Option D.
The atoms and molecules of the liquid water are moving, and the atoms and molecules of the
table are not moving.
Explanation:
The atoms and molecules of the liquid water are moving, and the atoms and molecules of the table are not moving and this is because the atoms and molecules of liquid water are closely packed together and they collide to each other often, thereby moving in random motion in all directions.
The molecules of solid cannot move because they are closely packed together and there is a very strong of attraction which make them to only vibrate and not move and this make solid to have definite shape.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
