1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alina [70]
3 years ago
11

A gene in which the heterozygous condition is displayed differently in males and females is referred to as _______.

Biology
1 answer:
N76 [4]3 years ago
8 0
Sex influenced I think
You might be interested in
How do ldl and hdl differ structurally and functionally?
ZanzabumX [31]

The main structural difference between LDL and HDL is their compositions. Approximately 50% of the weight of an LDL particle is cholesterol and only 25% is protein. High-density lipoprotein particles, on the other hand, consist of 20% percent cholesterol by weight and 50% protein.

5 0
3 years ago
Can living thing survive without other living things? Explain the answer?
Alona [7]
Living things cannot live without eachother due to the food chain, if an animal loses it's food so will his predator and so on. Soon they will end up extinct, this is why it's important to take care of animals.
7 0
3 years ago
What properties classify diamond as a gemstone?
MatroZZZ [7]
A gemstone is a piece of hard mineral that is considered exquisite in terms of physical properties and valuable because of its rarity or usefulness. In this case, the properties classify diamond as a gemstone is its <span>color and profitability. Diamonds are very expensive because of its rarity</span>
8 0
3 years ago
What does it mean when they say genetic.
olya-2409 [2.1K]

Answer:

relating to or determined by the origin, development, or causal antecedents of something

Explanation:

3 0
3 years ago
Read 2 more answers
A pig that has a curly tail (he is heterozygous for this trait) mates with a pig that has a straight tail. Curly tails are domin
Aleks [24]

Answer:

Curly?

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • A client who developed gestational diabetes mellitus during the pregnancy has just been admitted in the labor and delivery unit.
    10·1 answer
  • Identify one of the mrna codons that would stop the coding process
    10·1 answer
  • This occurs when a shadow makes the sun or the moon seem to grow dark
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Acetic acid, commonly known as vinegar, is sour. Which functional group is present in acetic acid?
    6·1 answer
  • Ecological Succession in order
    7·1 answer
  • Please help with this biology question!
    5·2 answers
  • 1. If x and y vary inversely and x=3 when y=8, find y when x=4*<br> Oy=12<br> Oy=6<br> Oy=5<br> y=2
    11·1 answer
  • What is the answer to this
    15·1 answer
  • PLZ HELP THIS IS DUE TODAY!!!<br><br> Why is figure 3 more helpful than figure 2?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!