1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artyom0805 [142]
3 years ago
9

True or false: The sequence of nucleotides in DNA codes for proteins and is key to cell function and life.

Biology
2 answers:
kondaur [170]3 years ago
4 0
The answer is true for both 13 and 14. im not positive but i have just recently gone over this.
Dmitry [639]3 years ago
3 0

13. true

14 true


i hope this helps you

You might be interested in
Suppose you were interested in the effect of breastfeeding versus formula feeding on the composition of gut flora in newborns. A
Goshia [24]

Answer:

vAurora

Explanation:

5 0
2 years ago
Describe how natural selection can occur in a population. Choose an organism that you suspect has undergone natural selection, w
Ahat [919]

Following general conditions are necessary for natural selection to occur in population:

  • More organisms are born than can survive.
  • Organisms vary in their characteristics, even within a species.
  • Differences in reproduction and survival are due to variation among organisms.

According to Charles Darwin's theory of evolution by natural selection, organisms that possess heritable traits that enable them to better adapt to their environment compared with other members of their species will be more likely to survive, reproduce, and pass more of their genes on to the next generation.

Galapagos Finches: The Galapagos finches studied by Darwin on his famous voyage are probably the most common example of natural selection.

5 0
4 years ago
Which of the following explains how a child might have blue eyes?
irinina [24]
The answer is c: the child received genes from both of the parents
8 0
3 years ago
Sometimes a mutation is beneficial to an organism’s fitness and can be passed on to offspring. What is likely to happen to the m
Allushta [10]

The mutation will occur often in offspring and leads to development of genetic variability in the gene pool.

Answer: C

Explanation:

Mutation refers to the process which causes disturbances in the normal DNA pattern.

When such phenomenon occurs over many generations, it will become a common process in offspring and increase the chance of difference in variability in the genetic makeup as well as the gene pool.

It is because, the first stage of mutation appears tedious to the organism.

As it gets transferred from one generation to another generation, the species due to its capability identifies certain ways and exhibit genetic variability due to the mutation.

By this way the mutation will become more common in offspring as their parent have mated in the presence of mutation.

4 0
4 years ago
Read 2 more answers
Name the following.
sdas [7]

Answer:

I believe this happens when you clone DNA in a lab.

Explanation:

Hope this helps!

7 0
3 years ago
Other questions:
  • PLEASE ANSWER ASAP EMERGENCY PLEASE!!!! I WILL MARK BRAINLIEST!!!
    11·1 answer
  • What are synapomorphies
    9·1 answer
  • Why do 02 and CO2 pass through the plasma membrane?
    13·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Engineering is <br>scientists use what to write down their information and numbers ​
    11·1 answer
  • Какие факторы нарушают природные закономерности биосферы?
    5·1 answer
  • PLS SOMEBODY HELP!!!!<br> Then they want us to name 4 mRNA bases for the codon
    15·1 answer
  • Name one fossil anima​
    5·1 answer
  • Life cycles recycle matter and help to create balance on Earth because
    10·1 answer
  • Example of factor isolating question​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!