1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mamont248 [21]
3 years ago
15

Positive feedback differs from negative feedback in that:

Biology
1 answer:
Mamont248 [21]3 years ago
4 0

Answer:

C. Positive feedback results in increases in some parameter (such as body temperature), whereas negative feedback results only in decreases to the paramenter

Explanation:

Positive and negative feedback are essential to the body's homeostasis, or to maintain balance and regulate the internal environment of organisms; that is to say, they are important for the organisms to self-regulate themselves. Positive feedback is in the same direction as the initiating stimulus as they amplify the original stimulus. Positive feedback leads to an increase in a reaction, thus amplifying the effects of a reaction. However, negative feedback decreases a reaction; negative feedback stabilizes the system.

You might be interested in
A spoon is manufactured out of plastic using an injection molder. Which is the most suitable secondary material to use?
Galina-37 [17]

Answer:

wood

Explanation:

7 0
3 years ago
Which RNA nucleotide is complementary to adenine?
Yakvenalex [24]

Answer:

It would be uracil

Explanation:

RNA base pairs:

A - U

G - C

5 0
3 years ago
Read 2 more answers
If soil is found on the bottom of a shoe, the soil is left on the shoe and the entire shoe is taken to the crime lab.
Tcecarenko [31]
The answer should be True
4 0
3 years ago
Read 2 more answers
Helloooooooooooooooooooooooooooooooo
Leni [432]

Answer:

B.) Deposition

Explanation:

Deposit means to take something away and move it.

5 0
3 years ago
Read 2 more answers
Please HELP the correct answer will get BRAINLIEST! What nutrient fits the table? I already did Vitamin A, C and D and I also di
KatRina [158]

Answer:

<em>A</em><em> </em><em>SOLVENT</em><em> </em><em>FOR</em><em> </em><em>MANY</em><em> </em><em>DIFFERENT</em><em> </em><em>CHEMICAL</em><em> </em>

<em><u>ANSWER</u></em><em><u>:</u></em>

<em><u>water</u></em>

  • <em><u>waterWater is capable of dissolving a variety of different substances, which is why it is such a good solvent. And, water is called the "universal solvent" because it dissolves more substances than any other liquid. This is important to every living thing on earth.</u></em>

<em><u>ANY</u></em><em><u> </u></em><em><u>KIND</u></em><em><u> </u></em><em><u>OF</u></em><em><u> </u></em><em><u>DRINK</u></em>

<em><u>ANSWER</u></em><em><u>:</u></em>

  • <em><u>WATER</u></em>
  • <em><u>COKE</u></em><em><u> </u></em>
  • <em><u>ORANGE</u></em><em><u> </u></em><em><u>JUICE</u></em>
  • <em><u>MILK</u></em><em><u> </u></em>
  • <em><u>COFFEE</u></em>

<em><u>#</u></em><em><u>CARRY</u></em><em><u> </u></em><em><u>ON</u></em><em><u> </u></em><em><u>LEARNING</u></em><em><u>:</u></em><em><u>)</u></em>

8 0
2 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • When apoptosis occurs, the following takes place EXCEPT for:
    5·1 answer
  • The combined alleles of all the individuals in a population is called the
    6·1 answer
  • The __________ is the area of the brain in humans that serves to coordinate complex voluntary movements, posture, and balance.
    12·1 answer
  • Most stars end their lives as which type of star?
    11·1 answer
  • What is the normal heart rate for an adult who is sitting quietly
    5·2 answers
  • Please help me on this not even sure on this. Thank you
    9·2 answers
  • What are the female parts of the flower called?
    6·2 answers
  • Which type of tree does not have rounded cones and most of the leaves are not sharp
    5·1 answer
  • Tesla needs to create a project that shows geographic isolation in action and decides to make a video. Which of the following wo
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!