The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
Answer:
How do limiting factors affect population size?
Explanation:
Limiting factors are factors that affects the size of a population and slows down its growth rate or stop it in its entirety.
These factors include food, space, temperature, sunlight etc.
Limiting factor like food can affect a population greatly like not having enough preys in a forest, therefore the predators are starved to death or even in a fish pond where there is high competition for space (overpopulated) which leads to oxygen deficiency i.e they compete for oxygen as well, and this can lead to death as well.
The answer to this question is:
A) Chromatin
Had to correct myself, sorry. Hope I helped.
Answer:
C) It does not show the increasing human population and their activities have a tremendous impact on the carbon cycle.
Explanation:
geological isolation, if the birds that develop mutations do not have any competition they can survive.
