So the answer for (a) is basically the enzyme is breaking down the protein (which is the colored part) and this leaves the clear.
For the constants it would be the film and the temperature that the solution is at
For the final question, they could be improved by using more data and multiple trials
Answer:
Squamous cell carcinoma presents with a firm, nodular lesion topped with a crust or with a central area of ulceration.
Explanation:
The nurse is providing home care instructions to the client who just had surgery for squamous cell carcinoma. The nurse provides follow-up teaching and explains to the client to watch for squamous cell carcinoma presents with a firm, nodular lesion topped with a crust or with a central area of ulceration. As we know "Squamous cell carcinoma" most generally emerges as a firm, soft, or hyperkeratotic papule either plaque, besides with convenient ulceration.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
<span>Organs are formed by tissues combined together.
</span><span>♡♡Hope I helped!!! :)♡♡
</span>
