1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mixer [17]
3 years ago
14

What is the appropriate age of criminal responsibility?

Law
1 answer:
Alona [7]3 years ago
8 0

Answer:

18

Explanation:

because it is the age to receive a identity card

You might be interested in
An employee filed in state court a civil action alleging sexual harassment in the workplace. She asserted federal statutory empl
kiruha [24]
Yes, they may remove the case to federal district court.
7 0
3 years ago
Drug And Alcohol Exam
forsale [732]
This answer is false because they can be very negative
6 0
3 years ago
Como as palavras estão organizadas nas estrofes?como são as letras que compõem o poema?
Mashcka [7]

Olá. Primeiramente, é importante ressaltar que você não pode postar perguntas em português fora do campo "World Languagens". Esse não é o servidor brasileiro e sim o americano, por isso perguntas em português s´´o podem ser respondidas dessa forma.

Em segundo lugar, você não apresentou nenhum texto, o que dificulta que a sua pergunta seja respondida. Entretanto, eu posso te ajudar, afirmando que dentro das estrofes de um poema, as palavras sãpo organizadas em versos. O conjunto de versos, forma uma estrofe.

Em relação as letras, só é possivel determinar com elas são, depois que a leitura do texto for feita, mas podemos afirmar que na maioria dos casos, as letras maiusculas são usadas apenas no inivio do verso, enquanto as letras minusculas são usadas em todos os versos.

4 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
The law of demand states that an increase in the price of a good.
love history [14]

The law of demand states that the increase in the price of a good causes  a resultant decrease in the quantity demanded of the good.

<h3>The law of demand</h3>

According to this law, when the price of a good is increased, ity would reduce the purchasing power of the users of the good. They would be able to buy only less of it.

But a price drop woukd make people to accumulate more of a good.

Read more on the law of demand here:brainly.com/question/24500422

8 0
2 years ago
Other questions:
  • Being a responsible driver will lead to...
    11·1 answer
  • Why have some states placed restrictions on intrastate and interstate branches? What historical laws gave this right to states?
    6·1 answer
  • Alcatuieste enunturi in care sa se afle :1) un atribut adjectival exprimat prin adjectiv provenit din verb la participiu ,2)un a
    10·1 answer
  • Someone please help me
    12·1 answer
  • Which of the following is a factor that causes a change in supply?
    14·1 answer
  • Rich history of theft offenses
    14·1 answer
  • What are typical behaviors of aggressive drivers
    10·1 answer
  • Se encarga de vigilar y evaluar el ejercicio del gasto público, para lo cual realiza actos de fiscalización, con la finalidad de
    12·1 answer
  • Kung ikaw ay magiging gobernador, ano ang iyong ipapangako sa bayan?​
    7·1 answer
  • What is the "first consideration" for policymakers?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!