1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Valentin [98]
3 years ago
9

Why do biologists use a classification system to group organisms?

Biology
1 answer:
KonstantinChe [14]3 years ago
3 0

Answer:

b. so organisms will have the same name all over the world

Explanation:

if a universal classification system is followed by everyone, the research, naming and the understanding becomes easier. The names need to be constant for people from every part of the world to know and understand. this prevents any clash of miscommunication between scientist and biologists all over the world. there's a separate branch in science that deals with classifying  organisms and giving them names that are universally accepted and followed. it is called taxonomy.

You might be interested in
A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
padilas [110]

Answer:

Explanation:

a. The template strand is:

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding strand is

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. GGAGGA

e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.

4 0
3 years ago
How do mutations increase genetic diversity in populations?
umka2103 [35]
Flow of individuals in and out of a population introduces new alleles and increase genetic variation within that population. Mutations: changes to an organisms DNA that create diversity within a population by introducing new alleles.
6 0
4 years ago
Why do solvent particles flow into the cell when the initial volume is below 50%?
vredina [299]

Answer: Differences in osmotic concentrations

Explanation: With solvent particles flowing into the cell, it means the concentration outside of the cell is higher and with initial volume less than 50%, then that within the cell is lower. This results in an osmotic gradient, allowing particles in areas of higher concentration (outside the cell) to flow into the cell, an area of lower concentration.

4 0
3 years ago
Read 2 more answers
DNA and RNA are nucleic acids made up of long strands of 100's of nucleotides. What is the only difference in each nucleotide?
dedylja [7]

Answer:

Nucleic acid types differ in the structure of the sugar in their nucleotides–DNA contains 2'-deoxyribose while RNA contains ribose (where the only difference is the presence of a hydroxyl group).

Explanation:

8 0
3 years ago
Which of these is a process during which the hydrosphere interacts with the exosphere?
ra1l [238]

Answer:

<em>The correct answer is C, absorption of heat in lakes and oceans</em>.

Explanation:

The hydrosphere represents all water on earth, while the exosphere represents the outer-shell of our atmosphere(pretty much space). With the sun coming from space, and the water (lakes and oceans) on earth absorbing that heat, it would create an interaction between the exosphere and hydrosphere.

3 0
3 years ago
Other questions:
  • How are novel variations added to a population?
    6·1 answer
  • Why are data tables useful in an experiment
    13·1 answer
  • The sum of the number of protons and neutrons in the atom is known as the _____
    6·2 answers
  • Which organ of the female productive system sheds an unfertilized egg every month
    8·1 answer
  • What are some proposed disadvantages to utilizing DNA technology? Check all that apply.ANSWER IS (reduced effectiveness of pesti
    9·1 answer
  • 1) Which is the variation<br> stage and why?
    5·2 answers
  • How many atoms does Ga 2(Cr2O7)3
    10·1 answer
  • Sucrase uses ____ to cleave sucrose into two monosaccharides.
    12·1 answer
  • Which of the following statements describes a benefit of most cells being
    6·1 answer
  • Which constituent of bile has a digestive function?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!