1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mylen [45]
3 years ago
5

In which organism does respiration not take place in the mitochondria

Biology
1 answer:
nataly862011 [7]3 years ago
3 0

Answer:

prokaryotic organisms

Explanation:

You might be interested in
4. If the rock sample contains 20 mg of tritium 3, how much<br> will remain after 48 years?
LekaFEV [45]

Answer:

eeikekenejndxkkxlxxjdnenxll

8 0
2 years ago
True or false: Large molecules called monomers are made of smaller subunits called polymers. A True B False​
Nonamiya [84]
Answer: True!

Reason: Because monomers are long chains of reapeating subuints in Polymers
5 0
3 years ago
Read 2 more answers
The ribosome is called the ____________ ; because it can read mRNA language &amp; turn it into amino acid language.
Scrat [10]

Answer:

DNA Translator

Explanation:

The ribosome is called the DNA TRANSLATOR; because it can read mRNA language & turn it into amino acid language.

This amino acid chain is known as polypeptide

6 0
2 years ago
During what stage does land get ready for the arrival of a new species
34kurt

Answer

           The correct option is B.

Explanation

          Ecological succession of any species is composed of following stages:

A. Migration

            The movement of species from one place to another location for the purpose of setting permanently o temporary is known as migration . Forexample

             Siberian crane (<em>Leucogeranus leucogeranus</em>) that live in the arctic tundra of eastern and western Russia. The eastern population of birds migrate to china while western population of these birds migrate to Iran, India and Nepal during winter season.

B. Ecesis

         The complete establishment of species in new habitat that was completely barren or left barren due to some catastrophe is known as Ecesion. This process is dependent upon the climatic, edaphic and biotic factors. The success of plant depend upon some of the adaptations to withstand the unfavorable conditions which includes both biotic and abiotic conditions.

Forexample

               The process of succession in xerosphere start on barren area from pioneer stage covered by crustose lichen, then foliose lichen followed by moss stage, herbaceous stage and a last by shrub stage.

C. Nudation

       The initiation of new species by major environmental disturbance such as volcano eruption is known as Nudation.

D. Reaction

            It represents the effect of established species on the habitat. Forexample plants alter habitat condition as they grow. They extract raw materials from the environment in large amounts and return metabolic wastes. The waste accumulates in large amounts and differ from the original raw materials, thus altering the environment.  

E. Competition

             The phenomenon which involves struggle for existence between two or more individuals growing in same area, that make excessive demand that are similar in nature on the soil is known as competition.

Such struggle may be in between same species or different species. The competition may be interspecific or intraspecific. Because of completion the weak individuals are eliminated as strong ones are retained.

 


8 0
2 years ago
How do we REMOVE water vapor (a gas) from our atmosphere?
NikAS [45]

Answer:

to get the heat of the planet

Explanation:

6 0
2 years ago
Other questions:
  • What is the “main sequence” refer to
    13·1 answer
  • What are three types of arthropods ?
    10·2 answers
  • Explain why hormones are able to travel through the body but only affect certain cells.<br><br><br>​
    8·1 answer
  • Why would the structures of organism look so differently even though they come from common ancestors
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Plant and animal cells differ in a variety of ways. Plants have a special structure that helps them produce their own food. With
    9·2 answers
  • What part in the us would a hurricane most likely strike
    10·2 answers
  • The (_______) has increased consumer knowledge about the connection between food and health.
    13·2 answers
  • Explain why the cell membrane is the brain of the cell, as opposed to the nucleus.
    12·2 answers
  • When two tectonic plates collide to form above ground volcanoes the plates are at a...
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!