1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex
3 years ago
8

7. Phytochrome prevents seeds of some plants from germinating when they are in deep shade by the: absorption of far-red waveleng

ths by chlorophyll. slow conversion of Pfr to Pr in the dark. absorption of red wavelengths by Pr. absorption of far-red wavelengths by Pfr. slow conversion of Pr to Pfr in the dark.
Biology
1 answer:
SIZIF [17.4K]3 years ago
4 0
<h2>Function of Phytochrome </h2>

Explanation:

  • The <em>color of light</em> that they absorb maximally by the two types such as   <em>Pfr is a blue-green structure</em> that ingests far-<em>red light (730 nm)</em> and<em> Pr is a blue structure that retains red light (660 nm)</em>
  • <em>Pfr assimilates far-red light</em>, it is changed over to the <em>Pr structure</em>
  • Pfr can spontaneously revert to the Pr form  structure in obscurity <em>dark over time = dark reversion Pfr</em> is additionally helpless to proteinases
  • <em>Pfr contains  some red light, so in red light 15% Pr and   there is a parity of 85% Pfr.</em>
  • <em>The  phytochrome (Pr)</em> is changed over to the organically dynamic structure red light with the <em>Pfr under illumination</em>
  • <em>Darkness and Far -red light convert</em> the particle back to the inactive form.
You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
These individuals had theories of evolution by natural selection, but did not receive the same credit that Darwin did: Group of
Sergeeva-Olga [200]

The individual who did not receive the same credit as Darwin was Alfred Russel Wallace.

<h3>What is the evolution theory?</h3>

The evolution theory is a scientific theory explaining how natural selection may change (evolve) phenotypes across generations.

Alfred Russel Wallace was an evolutionary biologist who understood the importance of natural selection on this process.

In conclusion, Alfred Russel Wallace did not receive the credit as Darwin.

Learn more about natural selection here:

brainly.com/question/23929271

#SPJ1

7 0
2 years ago
Eliana cuts a watermelon into several slices. Which statement best describes the physical change?
Nat2105 [25]

A. The arrangement of particles within the watermelon changed.

9 0
3 years ago
Read 2 more answers
How is an inference related to observation
marta [7]
Inferences are related to observations because inferences are an explanation for an observation you have made.
5 0
4 years ago
Read 2 more answers
Amphibians moved to a terrestrial environment; however, they did not evolve the ability to live their entire lives on land. Expl
Gekata [30.6K]

Answer:

See the answer below

Explanation:

<em>Amphibians are not totally adapted to live on land because the aquatic environment is needed for several life processes such as </em><em>reproduction</em><em>, </em><em>respiration</em><em>, and sometimes, </em><em>feeding</em><em>.</em>

<u>The eggs of amphibians are without any protective shells and will suffer desiccation in the terrestrial environment. Hence, water is needed in order to protect the eggs. In addition, the male am</u>phibians shed their sperm in the water close to the female eggs.

<u>The young ones of amphibians are essentially aquatic and may not survive out of water for a long time because they only breathe gills</u> - the lung is yet to develop or poorly developed at this stage. They have to grow and develop to a certain stage in water before they can start surviving on land.

3 0
4 years ago
Other questions:
  • Babies at high risk for stunted growth, poor health, and impaired functioning throughout life are dealing with the results of
    6·1 answer
  • Which of these satisfies a basic need for a chipmunk? A. string B. burrow C. rocks D. highway
    5·1 answer
  • What steps should you follow to measure humidity with a psychrometer?
    11·1 answer
  • Pls help me answer this question and pls put an explanation!!!!
    12·1 answer
  • Write how ATP works in a Cell
    8·1 answer
  • Why are ​ORGANELLES separated by their own membranes?!!!!!1
    7·1 answer
  • Match the following terms and definitions:
    15·1 answer
  • In which direction will the object pictured below be accelerating?
    14·1 answer
  • I am a real "powerhouse" 
    5·1 answer
  • Mendel's work was the foundation for understanding that ____.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!