1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vanyuwa [196]
3 years ago
12

The temperature differences between land and sea help create wind

Biology
1 answer:
riadik2000 [5.3K]3 years ago
4 0

Answer:

this is true

Explanation:

The air over the ocean is now warmer than the air over the land. The land loses heat quickly after the sun goes down and the air above it cools too. ... This causes a small temperature gradient between the ocean surface and the nearby land at night and the wind will blow from the land to the ocean creating the land breeze.

You might be interested in
Does global temperature effect the number and severity of tornadoes? What would be the control group or constant for this experi
Studentka2010 [4]
Yes considering tornadoes are formed by certain global temperatures.
4 0
3 years ago
If a plant has less chloroplasts you can assume that?
Aneli [31]

Answer:

if plants had less chloroplasts then they wouldn't be able to get energy from the sun and end up dying  

6 0
2 years ago
Which of the following are found in BOTH plant and animal cells?
bagirrra123 [75]

Answer:

The nucleus is found in both plant and animal cells along with the vacuole

Explanation:

4 0
3 years ago
Which protist is multicellular and can primarily be found in cool marine climates?
denis23 [38]
C
Brown algae
Im pretty sure this is correct
3 0
3 years ago
Read 2 more answers
Sources on janisim and bhudhism
joja [24]
Do you need specific sources on this for a paper? I️ would use easybib it is a great source to get bibliographies done quick.
3 0
3 years ago
Other questions:
  • A convalent bond is formed as a result of a
    8·1 answer
  • 1. Which event describes a change where evolution has happened?
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The male reproductive parts of a flower are called
    12·1 answer
  • Maya wrote the following characteristics of two landforms.
    15·1 answer
  • What do cyclins regulate?
    7·2 answers
  • Some species of algae grow on fungi. The algae makes sugars by the process of photosynthesis, which helps make food for the fung
    6·1 answer
  • Which of the following decreases the population size?
    7·1 answer
  • What is Electron Transport Chain and what happens in that stage of cellular respiration?
    9·1 answer
  • True or false? Vegetable oils are part of a balanced diet.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!