1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
raketka [301]
3 years ago
7

Which of the following is true about nucleic acids? I. Nucleic acids always consist of a five-carbon sugar, a nitrogenous base,

and one or more phosphate groups. II. Both DNA, which stores genetic information and encodes protein sequences, and RNA, which is involved in the direct production of proteins, are nucleic acids. III. Nucleic acids are usually insoluble in water and are used for long term energy storage. IV. Glucose, cellulose, and starch are examples of nucleic acids found in most cells.
Biology
2 answers:
Aleks [24]3 years ago
8 0

Answer:

II. Both DNA, which stores genetic information and encodes protein sequences, and RNA, which is involved in the direct production of proteins, are nucleic acids.

Explanation:

Nucleic acids are essential biomolecules for all living organisms. They carry genetic information and decode the production of proteins, necessary for the cell to reproduce. While they are formed of five-carbon sugars, a nitrogenous base they only have one phosphate group. They do not store energy. Also, glucose, cellulose and starch are not nucleic acids, they are carbohydrates.

Evgesh-ka [11]3 years ago
5 0
Hi!
<span>I. Nucleic acids always consist of a five-carbon sugar, a nitrogenous base, and one or more phosphate groups.
</span>
<span>II. Both DNA, which stores genetic information and encodes protein sequences, and RNA, which is involved in the direct production of proteins, are nucleic acids.

Please tell me if I'm wrong.
Good Day
</span>
You might be interested in
Please I need help with question 50 which is how much time does it take Earth to move from position A to position B and it’s ver
never [62]
91 days. it takes 365 days to go all the way around the sun. so divide that by 4 and you get 91

3 0
3 years ago
A brown cow is mated with white cow and they produce a roan cow Roan cows are brown with white spotsWhich statement best explain
jek_recluse [69]
C.
In co-dominance both traits show up, and in incomplete dominance the two traits mix together.

So automatically A, B and D are wrong, since we can see both brown and white colors on the cow separately.

If it were any of those we wouldn't be able to see any of the traits alone they would be a mix.
4 0
3 years ago
You have decided to cross your golden retriever (bbee) with the neighbor’s chocolate retriever (bbEe). What color pups will th
Kisachek [45]

Answer:

Chocolate Retriever

Explanation:

because the dominate letter (E) will over rule the lower caseletter

5 0
4 years ago
How does a dog fulfill the three points of the cell theory?
castortr0y [4]

Answer:?By stinking up the house

Explanation:Sorry im silly

7 0
2 years ago
What is the relationship between cilia and the cytoskeleton?
iren2701 [21]

The cytoskeleton provides energy to cilia

Explanation:

The motion of hair-like structures or axonemes called cilia or flagella are done through sliding movements of one another. This motion needs energy and motor protein molecules called dynein.

Dynein is a cytoskeletal motor protein present in the cytoskeleton and moves in the microtubules and converts the chemical energy in the ATP to mechanical energy to power the sliding and bending movements of cilia.

Apart from facilitating movement, cytoskeleton also contains other proteins which helps it to provide shape and support.

6 0
3 years ago
Other questions:
  • During which era did the supercontinent Pangaea break up?. . A.. Mesozoic. . B.. Cenozoic. . C.. Precambrian. . D.. Paleozoic
    5·2 answers
  • A researcher is evaluating the expression of p53 in cells she is culturing in the laboratory. She notices that in a small group
    5·1 answer
  • many trees seems to readily survive the loss of their leaves even though they are the main photosynthesizing organ.How is this p
    10·2 answers
  • If there were no laws controling the crab industry ,what would happen to crabs?
    15·1 answer
  • Why are x linked disorders more prevalent in men than women?
    7·2 answers
  • For insects that go through incomplete metamorphosis, what is the difference between the nymph and the adult?
    15·1 answer
  • Using the karyotype above, answer the following questions:
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Only some living things have genetic information.
    7·2 answers
  • Ex. 1=<br> Ex 2 =<br> Which example is law or theory:<br><br> EXAMPLE HOW YOU KNOW
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!