1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blsea [12.9K]
3 years ago
7

Which of the following statements about the cytoskeleton is incorrect? A. The dynamic aspect of cytoskeletal function is made po

ssible by the assembly and disassembly of a few simple types of proteins into large aggregates. B. Microfilaments are structurally rigid and resist compression, while microtubules resist tension (stretching). C. Movement of cilia and flagella is the result of motor proteins causing microtubules to move relative to each other D. Transport vesicles among the membranes of the endomembrane system depend on the function of the cytoskeleton.
Biology
1 answer:
Jet001 [13]3 years ago
3 0

All the options given above are correct.

Microfilaments are the thinnest filament of the exoskeleton and they are found in the cytoplasm of eurkaryotic cells. The polymers that made up the microfilament are flexible and strong and they provide support for the cell.

hope this helps you out...good luck!

You might be interested in
True or false the center of the earth is very hot
Fantom [35]

Answer:

true very true

4 0
3 years ago
Read 2 more answers
Fill in the sentences to complete the statements about meiosis.
Debora [2.8K]

Answer:

23 chromosomes.

Explanation:

Meiosis is the process by which the chromosome number is halved during gamete formation. So chromosomes are 46 and get halved to 23 during the process of meiosis.

3 0
3 years ago
Which include the male and female sex cells?
scZoUnD [109]
It's Gametes Sexual reproduction is the union of male and female gametes to form a fertilized egg, or zygote. The resulting offspring inherit one half of their traits from each parent.
6 0
3 years ago
1. If x and y vary inversely and x=3 when y=8, find y when x=4*<br> Oy=12<br> Oy=6<br> Oy=5<br> y=2
natta225 [31]
Can you please take a picture of the question. Because I don’t understand it in this format
3 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which term describes an extensive network of tubes, sacs, and vesicles throughout a cell that provides transport as its main fun
    16·2 answers
  • In what ways do humans impact different ecosystems?
    14·1 answer
  • Please help me...
    10·2 answers
  • Which best describes Mowgli's conflict with his own thoughts and feelings?
    5·1 answer
  • What stores digestive enzymes that break down lipids, carbohydrates, and proteins into small molecules that can be used by the r
    8·1 answer
  • an ocean wave has a wavelength of 8 meters and wave period of 4 seconds. what is the wave speed? A. 2 m/s B. 4 m/s C. 12m/s D. 3
    5·1 answer
  • Flowers are a good adaptation for life on land, because they allow plants to hold onto more water. Is it true or false
    7·1 answer
  • What would happen to an organism if mitosis did not occur? Check all that apply.
    13·2 answers
  • Compare the carboniferous period to the devonian period. thanks for answering :]
    6·2 answers
  • Which of the following is a problem that resulted from the Green Revolution?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!