The answer is the endogenous opiate.
The human body naturally produces its own opiates like substances and uses them as neurotransmitters. These substances include endorphins, enkephalins, and dynorphin, often collectively known as endogenous opioids. Endogenous opioids modulate our reactions to painful stimuli.
<span>i think it is a.Molecules move against their concentration gradient. hope it helps
</span>
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
They both are better to eat before a race