1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanya [424]
3 years ago
7

Which graph best represents directional selection? edit; the answer is B

Biology
2 answers:
marin [14]3 years ago
6 0

Answer: Where is the question?

Explanation:

maw [93]3 years ago
5 0

Answer:

The answer is graph B

Explanation:

You might be interested in
When you are rating evidence by its value, weigh the benefits of one good fingerprint versus hair and fiber evidence. Fully expl
Zinaida [17]

Answer: Conviction based on the support of the physical fingerprint is a more reliable evidence over hair and fiber evidences.

Explanation:

Physical fingerprint has more value than hair and fiber evidences. As no two fingers can have exactly alike fingerprints belonging to the same person. The fingerprints of two identical twins cannot be alike but DNA evidence obtained from hair, fiber, or any other biological evidences can show similarity. Thus physical fingerprint have more value over DNA fingerprint it can directly related to a suspect to whom it belongs to depending upon the uniqueness of the minutiae characteristics.

6 0
3 years ago
Homologus chromosome are separted
brilliants [131]
Homologous chromosomes are separated during anaphase of meiosis.
8 0
3 years ago
Read 2 more answers
What female organ is homologous with the male's scrotum?
SCORPION-xisa [38]

Answer: E

Explanation:

3 0
3 years ago
How evaporative salts form
ch4aika [34]

Water evaporates salts in seawater increase in concentration. Minerals precipitate

4 0
3 years ago
Atp is much better at doing what​
allochka39001 [22]

ffyrtdrtfdckttftfctyytftfftdeededtgtgvgkgyhkjktgjtgtfjcfvcfcseg bnmvgfgfchftgytgyvg  nhvcjhjjryxchevdrftloiuymhecdfhgjlj

5 0
2 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Hydrophilic molecules tend to be ________ to water. Attracted mixed repelled absorbed
    13·1 answer
  • If it is 12:00 noon in California,what time is it in Virginia?
    12·2 answers
  • The parasympathetic division of the autonomic nervous system A. is associated with "fight or flight." B. opposes the effects of
    9·1 answer
  • How many trips has Earth made around the Sun in 8 mar years
    6·1 answer
  • I really need help can some give me the answer. I will be very thankful <3
    14·1 answer
  • PLZ HELP<br> i'll give brainliest to whoever answers best<br> What are biogeochemical cycles?
    10·2 answers
  • What causes different versions of the myostatin protein
    14·1 answer
  • What is the relationship between capillaries and lymph vessels
    5·1 answer
  • In which group of marine animals are dolphins classified?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!