1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kramer
3 years ago
9

Shortly after adopting his cat, Sassy, Thomas realizes that his poor cat isn’t eating very much. After ruling out any illnesses,

he determines that Sassy is a huge diva and is simply very picky about the type of food she eats. He decides to run a month-long experiment, separated into four weeks. During the first week, he feeds Sassy normal dry food. During the second week, he feeds her wet canned food. In the third week, he gives her raw salmon. Finally, throughout the fourth week, Thomas feeds Sassy a home-cooked meal of liver and gravy. At the end of the experiment, Thomas compares how much of each type of food Sassy ate. The independent and dependent variables also the control group and the experimental group. finally 3 constants
Biology
1 answer:
Darya [45]3 years ago
8 0

Answer and Explanation:  

During an experiment, data from an experimental group are compared with the data of a control group. These two groups are identical in all aspects except for the independent variable that the researcher changes in the experimental group to observe how they affect the individuals. This variable keeps constant in the control group.  

  • The experimental group is the one that receives the experimental procedure, with changes in the independent variable. There can be several experimental groups. In the exposed example, the experimental groups are the different types of food.  
  • In the control group, the variable measured keeps constant, not influencing the results. This isolates the effect of the independent variable on the experiment and helps to find alternative explanations to the different results.  The control group corresponds to the normal dry food.
  • Manipulated variable: Refers to all the variables in an experiment that provoke a response in another variable. They are also known as independent variables. The researcher can change these variables to see what changes it implies in an object, process, trait, or anything that depends on them. In the exposed example, the researcher manipulates the type of food he gives to the cat.
  • Responding variable: Refers to the dependant variable, which response depends on any change in the independent variable. A change in the dependent variable might be proportional or inversely proportional to the change in the manipulated variable. In the exposed example, the dependent variable is the response of the cat to the change of food.  
  • constants Feeding time with each type of food (one week per food)

                          Sassy being healthy

                          Sassy being picky  

You might be interested in
How to be gay plz tell me i want to know
SIZIF [17.4K]

Answer: By liking a boy or man.

4 0
3 years ago
Read 2 more answers
Given the sequence ATGGCGAATCACGTCACTTGA
Marina86 [1]

Answer:

a. TACG

b.UAC CGC UUA GUG CAG UGA ACU

c.ATCG

d.ser-arg-leu-val-ser-stop-thr

Explanation:

4 0
3 years ago
During a study that lasted several years, a researcher found that the number of breeding pairs of Florida scrub jays in the stud
Aneli [31]

Answer:

Option (A).

Explanation:

Limiting factors may be defined as the factors that are responsible for the limit of the population size and slows its growth. Both biotic and abiotic factors can acts as limiting factor for the population growth.

The scrub jays limits its size due to the limiting factors. The amount of food available in the area can acts as the limiting factor for the scrub jays. The limitation of food prevents the increase of scrub jays in the habitat.

Thus, the correct answer is option (a).

5 0
2 years ago
What type of landforms will result from the plate movement shown in the diagram?
Zepler [3.9K]
Whats the diagram??? @Valery123

4 0
2 years ago
A student made a model of an onion skin cell she viewed
Komok [63]

If a student made a model of an onion skin cell using a microscopic magnification scale of 500:1 and the length of the modeled cell is 15 cm, the real cell's length would be 0.03 cm.

The scale is 500:1. This means that the dimension of the real cell without being magnified under the microscope would be 1/500.

Thus, if the length of the cell under the microscope is 15 cm. This length has been multiplied by 500. In order to get the real length, it must be divided by 500.

              15 x 1/500

                             = 0.03 cm

More on microscopic magnification can be found here: brainly.com/question/14668612

6 0
3 years ago
Other questions:
  • Availability of substitutes plays a role in determining the bargaining power of suppliers.
    15·2 answers
  • What experimental evidence led to the development of this atomic model from the one before it? A few of the positive particles a
    15·1 answer
  • What protects the sperm and then escorts them on the beginning part of thier jouney
    6·1 answer
  • What is the most likely result of a cell with a mutation in the gene that codes for the enzyme primase?
    6·1 answer
  • Sunflower bending towards the sunlight is and example of?
    6·2 answers
  • SKIN
    11·1 answer
  • Someone please help me I will mark you BRAINLIST I need help with all 6 questions please
    15·1 answer
  • Name and describe at least 3 ways carbon moves between reservoirs.
    9·1 answer
  • What are haploid cells, and which cells are haploid?
    13·1 answer
  • What is Sensitivity ?<br>​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!