1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stepladder [879]
2 years ago
13

Vertebrate locomotion results from the contraction of muscles anchored to what other tissue?

Biology
2 answers:
liraira [26]2 years ago
8 0

Answer:

Bones

Explanation:

Bones are tissues that provide the body with rigidity. It also acts as the body's supporting structure.

The bone helps to maintain the body's shape at all times and provide a surface for the attachment of muscles. Joints are the points of contact between two bones. The bones, muscles and joints are very important in the locomotion(movement) process because there’s a synergy between them.

tigry1 [53]2 years ago
6 0

Answer:

Vertebrate locomotion results from the contraction of muscles anchored to bone tissue.

Explanation:

Vertebrates are the organism which contains spinal cord or backbone in their body. Locomotion is the ability of vertebrates due to which they can move from one place to another. The body of vertebrates comprise of bones which gives proper shape, support and helps in the movement from place to place. Bone is a type of hard tissue which is composed of calcium. In the body of vertebrates bones are moved with the help of muscles which are attached to it.

You might be interested in
At which stage is glucose broken into smaller molecules? A. before cellular respiration begins B. during the first stage of cell
Vesnalui [34]

b. the first stage because it could never be in the secound stage

8 0
3 years ago
Read 2 more answers
Que son las vorticelas?
Lady_Fox [76]
VORTICLAS ISN'T A WORD
4 0
3 years ago
Explain why all mutations are not necessarily harmful.
riadik2000 [5.3K]
Some mutations in living species help them to adapt and help protect them from predtors
5 0
3 years ago
Read 2 more answers
Plz be my new friends on gmeet<br> vtb-aibf-wha
rusak2 [61]

Answer:

no but i got my acc deleted lol

Explanation:

7 0
2 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • The skeletal diagram below shows variations that were present in their common ancestor. Using the diagram determine what most li
    8·1 answer
  • The fossil record shows that organisms in older rock strata are simpler than those found in younger rocks. This observation prov
    11·2 answers
  • in he three domain system, the domain Eukarya consist of all organisms that have which of he following
    8·1 answer
  • Why SA node called pacemaker of heart
    6·2 answers
  • What is puberty for girl
    13·2 answers
  • Another way to say reactants is?
    10·1 answer
  • How do you think a short-legged sheep would fare in the wild?Make a list of advantages and disadvantages..
    14·1 answer
  • Which activity requires a new pair of gloves between steps?
    7·1 answer
  • PLEASE HELP ME!!!! 100PTS I NEED IT RIGHT AWAY!!!!
    13·1 answer
  • Plz help
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!