1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
In-s [12.5K]
2 years ago
15

GENETICS VOCABULARY QUIZ

Biology
1 answer:
wariber [46]2 years ago
8 0
1. The story is talking about the dogs fur color.
2. The alleles are BB, bb, and Bb
3. The BB or black fur is dominant
You might be interested in
In a wind turbine, wind turns the blades, which turn a generator. This produces electricity. What energy conversion is
Zepler [3.9K]

Answer:

kinetic to electrical

5 0
2 years ago
Read 2 more answers
Question 13 (1 point) How much does hair grow on average in one month?
marshall27 [118]
I believe it’s A Explanation, On average, hair tends to grow between 0.5 and 1.7 centimeters per month. That is about 0.2 to 0.7 inches. And I’m really sorry if I’m wrong but hope I helped
4 0
2 years ago
How does the excretory system work with the muscular system?
Norma-Jean [14]

Answer:

How the Muscular and the excretory system work together. The Muscular system helps the Excretory system by moving waste through the body and protect its organs. The Excretory system helps the Muscular system by getting rid of carbon dioxide from the muscles.

Explanation:

4 0
3 years ago
WILL MARK BRAINLEST. Punnett squares use mathematical probability to help predict the genotype and phenotype combinations in gen
Y_Kistochka [10]
I believe it is C :)
8 0
2 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • The biosphere is the only one of Earth’s systems that contains life. Please select the best answer from the choices provided T F
    12·2 answers
  • 20 overall, around ___________ teenagers contract an sti sexually transmitted infection) each year.
    14·1 answer
  • If you were a doctor, and a lab technician told you that the results of a patient’s lab test were Gram positive, what antibiotic
    9·1 answer
  • Which of the following foods can be included in the diet plan for a patient with celiac disease?
    14·1 answer
  • Multiple Select Question
    5·1 answer
  • Which region of your brainstem plays a role in arousing you to a state of alertness when, for example, you accidentally stumble
    15·1 answer
  • Giraffes with short necks tend to be unable to access enough food, while giraffes with long necks can reach more food at the top
    6·2 answers
  • HELPPPPPPPPPPPPPPPPPPPP
    7·2 answers
  • Lizard is a poikilothermic animal give reason please​
    6·2 answers
  • What is the average for the following set of measurements?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!