The production of these crops is centered in the eastern third of the state but there are notable concentrations elsewhere, particularly in the river valleys of the Arkansas River (central Arkansas) and the Red River (southwest Arkansas).
Answer:
Answer: Water rise to tall trees by suction pull during day it is low but during night time it is fast. during night time transpiration is fast and transpiration create a pressure also called transpirational pull which cause root water to move at leaves.
Explanation:
The colors for the stars are red, white, blue-white, white, and blue, and their temperature are 3,910 K, 3,500 K, 25,200 K, 22,400K, 5,780K, 9,600 K.
<h3>What is a star?</h3>
A star is a type of celestial body that can be set apart from others because it shines due to inner radiation. Moreover, stars are classified by:
- Color
- Size
- Location
- Temperature
- Age
Now, let's identify the color and temperature of the stars:
- Aldebaran: This star has a temperature of 3,910 K and its color is red.
- Betelgeuse: This star has a temperature of 3,500 K and its color is red.
- Sirius B: This star has a temperature of 25,200 K and its color is white.
- Spica: This star has a temperature of 22,400K and it is a blue-white star.
- The Sun: This star has a temperature of 5,780K and its color is white.
- Vega: This star has a temperature of 9,600 K and it is a blue star.
Learn more about stars in: brainly.com/question/2166533
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
During interphase, the cell grows and builds the nutrients required for the stage called Mitosis that prepares it for cell division and manipulate the dna
