1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bija089 [108]
3 years ago
8

The presence of a transit sequence directs a protein from the ________ to the ________. The presence of a transit sequence direc

ts a protein from the ________ to the ________. signal recognition particle; nucleus cytosol; plasma membrane endoplasmic reticulum; Golgi apparatus endoplasmic reticulum; nucleus cytosol; mitochondrion or chloroplast
Biology
1 answer:
mote1985 [20]3 years ago
6 0

Answer:

The correct answer is "nucleus cytosol; mitochondrion or chloroplast".

Explanation:

A transit sequence, also known as signal peptide, in a protein is a series of amino acids that indicate that a protein is not synthesized matured, and a portion of the protein must be cleaved in order to have the protein in its mature form. Transit sequences serves as regulators of protein transport, since they indicate that a protein must transit from the nucleus cytosol to different organelles, such as the mitochondrion or chloroplast. Examples of this type of proteins, include: alcohol dehydrogenase, DNA polymerase, and RNA polymerase.

You might be interested in
10 points
dalvyx [7]

Solids-holds its shape

Liquid-take the shape of whatever its in

Gases- don't take a shape up

5 0
3 years ago
Arrange the events in the life of a star in the correct order
DerKrebs [107]

Answer:

243516

Explanation:

6 0
3 years ago
Read 2 more answers
What is caused by a tight agonist muscle decreasing the neural drive to its functional antagonist
ivanzaharov [21]

Answer:

<em><u>Altered Reciprocal Inhibition</u></em> is cause by a tight agonist muscle decreasing the neural drive to its functional antagonist.

6 0
3 years ago
HELP! BIOLOGY EXPERTS!!!!!
julia-pushkina [17]
B :) :) :) :) :) :) :) :)
8 0
3 years ago
Read 2 more answers
Adolescent or Infancy had rapid growth? Explain
Mkey [24]
Infancy, you grow from microscopic to a baby size in 9 months which is the fastest you ever grow.
8 0
3 years ago
Other questions:
  • What is a possible benefit of regulating the process of cell differentiation?
    11·1 answer
  • An infection acquired by a patient in a healthcare facility is known as a(n) ________ infection.
    11·1 answer
  • Unit Test Which title best fits Rahma's notes? Rahma took these notes on a process involving the movement of molecules, but she
    14·3 answers
  • Select the correct location on the map.
    14·1 answer
  • 50 POINTS
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How many genders are there?
    13·2 answers
  • Light energy is converted to chemical energy which is what
    6·1 answer
  • The mouse population would most likely decrease if there were?
    12·1 answer
  • Dna composition in mitiosis does it get half in daughter cell
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!