1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zmey [24]
3 years ago
12

Ripping up a piece of paper is physical change or chemical change?

Biology
2 answers:
telo118 [61]3 years ago
5 0
This is considered physical change because we are physically doing it. Chemical would be a reaction like color,smell or taste
eduard3 years ago
3 0
Hello there!

Ripping up a peice of paper is considered physical change.

Physical change means its still the same, it just changed shape.

Chemical change cannot be changed back.

For ex) Burning paper.

Its a chemical change because it cant be undone

hope this helps!

~DL
You might be interested in
it requires 12 hours to fill 3/5 of a swimming pool at this rate how many hours is required to fill the remainder pool
emmasim [6.3K]
So if you take the 12 hours that it takes to fill the swimming pool 3/5 way then u divide 12 by 3 and you would get 4 which would mean each quarter took 4 hours then it would take 8 more hours to fill the rest of the swimming pool
6 0
3 years ago
Which picture below is showing DNA polymerase making more DNA
dlinn [17]
No pic dummy .......
7 0
3 years ago
The table below shows the number of chromosome pairs for various organisms.
Ray Of Light [21]

there is no table in the question

6 0
3 years ago
Read 2 more answers
A biologist studying a desert ecosystem of theirs at the population of a lizard species increases of following a particularly ho
aleksklad [387]
The lizard preys the on the snake (a)

4 0
3 years ago
Why did dna technology lead to more use of cladistics?a. it showed that the linnaean system was the most accurate.b. it changed
Alexandra [31]
The correct option from given options is "b", that is <span> it changed ideas about which animals were closely related.
</span>Cladistics<span> was </span>invented for the purpose of improving on taxonomy and it is a way to deal with biological classification. DNA technology lead to more use of cladistics because it changed ideas about which animals were closely related and also it showed new evolutionary relationships between animals.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Biology helpp please,, tysm !! <br> reward is 10 points
    8·2 answers
  • Based on the scientific name streptococcus agalactiae, what morphology would you expect these cells to have? g
    7·1 answer
  • What is the outside of the virus made of?
    7·2 answers
  • Which of the following is not a part of Darwin's theory of evolution?
    10·2 answers
  • List all the organ systems
    14·1 answer
  • DNA may coil and condense into visible structures called?
    12·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • NP plants purple flowers are dominant to white flowers a white flowered plant across with a plant that’s is heterozygous for the
    15·1 answer
  • Which of these is transported by the xylem?
    13·1 answer
  • A lion cub resembles its parents because it inherits genes that produce.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!