1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-s [515]
4 years ago
8

What is a barrier island

Biology
1 answer:
Mkey [24]4 years ago
8 0

A Barrier Island is an island parallel to the coastline that protects the shore from erosion.

You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
PLS HELP A red flower is crossed with a white flower, producing offspring that are all pink. If two
Crank

Answer: b : 25%

Explanation:

7 0
3 years ago
Sensory receptors that are sensitive to chemicals are found in the a. skin, body core, and hypothalamus. c. eyes. b. skin, skele
Dmitriy789 [7]

Answer:

Explanation:

B?

6 0
3 years ago
Read 2 more answers
Why do you seldom see fossils in metamorphic rocks?
Sergeu [11.5K]

Answer:

Metamorphic rocks have been put under great pressure, heated, squashed or stretched, and fossils do not usually survive these extreme conditions.

Explanation:

8 0
3 years ago
What are some of the benefits of roundworms? Check all that apply.
Dmitriy789 [7]

Answer:

B) They feed on pests like termites, fleas, and ants.

D) They break down organic matter in the soil.

E) They aid in nutrient cycling.

Explanation:

It's on Edge 2020

3 0
3 years ago
Other questions:
  • Which helps maintain a dogs homeostasis?
    13·1 answer
  • Organisms are limited to reproducing only after their own kind by:
    13·2 answers
  • What is the name given to any group of tissues and organs that coordinate to perform related biological functions?
    14·1 answer
  • Is it from an Autotrophic or Heterotrophic organism? explain
    13·1 answer
  • A select mutation is causing a cell lineage to be unable to replicate DNA successfully. When observed under a microscope, resear
    11·1 answer
  • Is protein a living cell or a virus<br><br>​
    12·2 answers
  • When you walk your dog are you using energy from the sunlight ?
    9·1 answer
  • How does biomass change from lower to higher trophic levels?(1 point)
    6·2 answers
  • If you anwer these ill give free brainly give all stars and heart it
    11·1 answer
  • Bacterial shape is not a characteristic of the genus.<br><br> True<br> False
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!