1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
10

Please I need help with this

Biology
1 answer:
barxatty [35]3 years ago
6 0
TAAGCCGATAAATGCTAACGGTA
You might be interested in
Which statement is correct concerning the process of ecological succession? Shrubs will replace pines during succession. Primary
Mariana [72]

Answer:

Option (2).

Explanation:

Ecological succession is the change in the ecological community of the species with respect to time. Two  types of the succession are  secondary succession and primary succession.

The ecological succession includes various transitional stages before reaching to the climax community. The simple species acquires first and then the climax species is reached at the end of the succession. Different changes are involved in the formation of climax community.

Thus, the correct answer is option (2).

3 0
3 years ago
Order the terms from simplest to most complex:
Alexxx [7]
I think DNA Molecule:)
8 0
3 years ago
Read 2 more answers
If a snake species were introduced to an ecosystem where it had no natural predators,
Butoxors [25]

Answer:

I would say the answer is the first one, "They would compete with native snake species for resources, causing a decline in native snakes"    I'm not 100% sure i'm right but i'm pretty sure I am right ...

Explanation:

5 0
4 years ago
Read 2 more answers
Please help me with these!
romanna [79]
12.  D

13. B

14 . C


I hope I helped you. I don't know if I was helpful.
5 0
3 years ago
What season does the southern hemisphere experience when it is tilted away from the sun?
Vlad1618 [11]

Don't listen to the other answer (if it's still there) the answer is C. Winter

8 0
4 years ago
Other questions:
  • The four principal types of stress are __________.
    15·1 answer
  • What is the process that allows thermostats and thermometers to work?
    15·2 answers
  • Are organisms in the same family also in the same class
    5·1 answer
  • Describe how you can use a Punnett square to predict the probability that offspring will inherit a trait.
    15·1 answer
  • You bake a potato in a 2000 W toaster oven for 25 minutes how many joules of electricity did the toaster oven use how many kilow
    14·1 answer
  • Steve, a 32-year-old man, suffers from liver damage. Clinical examination reveals that it was caused by a toxin produced by a ce
    13·1 answer
  • Plzzzz help which of the following are correct about DNA fingerprinting
    6·2 answers
  • Explain what happens to the mass during photosynthesis and cellular respiration
    6·1 answer
  • A gene has the base sequence tac cg. give an example of a point mutation on this gene.
    6·1 answer
  • PLZ HELP 40PTSThe table below shows the mass of some horse fossils.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!