1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
10

Please I need help with this

Biology
1 answer:
barxatty [35]3 years ago
6 0
TAAGCCGATAAATGCTAACGGTA
You might be interested in
How do the DNA sequences<br> of the organisms compare<br> to one another?
larisa86 [58]

Answer:

Sometimes referred to as DNA-DNA hybridization, this process hybridizes the genetic information from two different organisms to determine similarities between them. Scientists separate strands of DNA from both species using heat, which breaks the bonds between the base pairs that link the two sides of the double helix.

Explanation:

6 0
3 years ago
Read 2 more answers
The process by which a bacteria cell divides into two identical cells is called
valentinak56 [21]
Binary fission is the process
7 0
3 years ago
Read 2 more answers
In most sexually reproducing organisms, the diploid phase of the life cycle begins at
valkas [14]

The diploid phase of the life cycle begins with the formation of the zygote.

Meiosis is referred to the type of cell division which occurs in the production

of male and female sex cells. This also occurs during sexual reproduction.

Parent cells provide male and sex cells such as sperm and egg which

contains DNA. They then fuse together to form a zygote which is the diploid

phase as a result of the fusion of two haploid cells. The zygote then

continues to undergo some meiotic processes which reduces it to back to a

haploid cell and consequent growth to form a fetus.

Read more on brainly.com/question/16249478

4 0
3 years ago
Without being in the presence of
victus00 [196]

A producer cannot make sugars in the absence of light, the correct option is A.

<h3>What are producers?</h3>

Producers, also known as autotrophs, are lifeforms that produce their own food.

They obtain energy from chemicals or the sun and transform it into usable energy in the form of sugar or food using water.

Plants and algae can produce their own food by harnessing solar energy. These organisms are referred to as producers because they generate their own food.

Thus, the correct option is A.

For more details regarding producers, visit:

brainly.com/question/4975822

#SPJ1

8 0
2 years ago
Which season is occurring in the southern hemisphere when earths northern hemisphere is tilted toward the sun?
Ksju [112]
The southern hemisphere would be experiencing winter :)

5 0
3 years ago
Other questions:
  • What is the term for an evolutionary change in one species that results in the evolutionary change of another species?
    12·1 answer
  • The nurse is caring for a spanish-speaking patient who is visually impaired. how can the nurse ensure an effective teaching–lear
    8·1 answer
  • Is cellular respiration an endothermic or exothermic reaction and explain
    8·1 answer
  • Which system is considered a parallel communication system to the nervous system in the body with its secretions passing directl
    7·1 answer
  • Which chemical is classified as an enzyme?
    15·2 answers
  • There is evidence from historical and genetic measures that supports the division of modern humans into subspecies. There is evi
    8·2 answers
  • Doctors often use certain medications to treat infections. A few people have a reaction to some of these medications, such as it
    5·1 answer
  • The hormones secretin and cholecystokinin target the pancreases. ---, and, ----to release juice and bile into the small intestin
    10·1 answer
  • Mollusks display ______ symmetry.
    9·2 answers
  • In a healthy population, there should be only young members represented.<br> A. True<br> B. False
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!