1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
10

Please I need help with this

Biology
1 answer:
barxatty [35]3 years ago
6 0
TAAGCCGATAAATGCTAACGGTA
You might be interested in
Which phrase best explains the term gene expression?
xenn [34]
What are the phrase options ??
5 0
2 years ago
A bird population only eats a certain type of plant. One year, flooding washes away most of these plants in an area. What will m
dedylja [7]
Immigration followed by competition
I hope this right, if its not, sorry =)
8 0
3 years ago
Read 2 more answers
You are trying to determine information about the structure of a protein that you have purified. You carry out a series of exper
aliya0001 [1]

Answer:

if I am not draw molecular weight of the directive functional protein is your answer give thanks to me

5 0
3 years ago
All parts of nonvascular plants must be near water because they have…
tiny-mole [99]

Answer:

B) Tiny roots.

Explanation:

:)

(:

:)

(:

Hope this helps!

<3

-Josh

brainliest if correct?

7 0
2 years ago
40 points please answer the two questions in the picture!!
nikdorinn [45]

Answer:

it's going to be called nucleotides

6 0
3 years ago
Read 2 more answers
Other questions:
  • Why is it so difficult to breathe when snorkeling at a depth of 1?
    14·1 answer
  • Wallace-Well's discussion of "The Great Filter" demonstrates:
    12·1 answer
  • Which set of properties distinguishes potential energy from kinetic energy?
    10·2 answers
  • The humerus is the long bone that extends from the shoulder to the elbow. Which skeletal system does the humerus belong to?
    13·2 answers
  • Inflammation
    11·1 answer
  • Marine Biology question
    13·1 answer
  • A person who is unable to resist infection by a particular pathogen is known as _______ in the chain of infection.
    9·1 answer
  • How many atoms of each element does sodium carbonate, Na2CO3, contain? Sodium = 1 atom, Carbon = 2 atoms, Oxygen = 3 atoms Sodiu
    8·2 answers
  • Can someone please help me with my science research I kind of need help in a few things that I listed, I’m currently working on
    6·1 answer
  • PLEASE HELP ME! ILL GOVE BRAINLIEST
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!