1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
10

Please I need help with this

Biology
1 answer:
barxatty [35]3 years ago
6 0
TAAGCCGATAAATGCTAACGGTA
You might be interested in
Which statement is true about precipitation in biomes around the world.
kolezko [41]

Answer:

Coniferous forest biome has more precipitation to the Deciduous forest biome.

7 0
3 years ago
Read 2 more answers
Some factors that contribute to a person's optimal personal health include nutrition, exercise, and genetics.
Yuki888 [10]

Answer: True

Explanation:

It should be noted that nutrition, exercise, and genetics contribute to the optimal personal health of an individual.

Good nutrition has a positive effect on the health of individuals. Exercise is also good for ones body. Some environments can being about an increase in the risk of developing certain diseases as well as ones genetics as some diseases are hereditary.

8 0
3 years ago
A trait that makes an individual different from other members of it species is called
Stels [109]

Answer: An inherited trait that makes an individual different from other members of its species is called a variation.

3 0
3 years ago
In the 1950s, the structure of DNA was discovered by using models and x-ray chromatography. Currently, science has used advanced
liberstina [14]
<h3><u>Answer;</u></h3>

Gene therapy to correct defective genes that cause diseases.

<h3><u>Explanation</u>;</h3>
  • Gene therapy refers to the procedure that involves the introduction of nucleic acids (DNA or RNA) into the cells of an organism for the purpose of correcting abnormalities, such as a mutations or in other words to treat a genetic disease.
  • Gene therapy entails bringing a normal and functional gene known as a trans-gene into a cell with altered gene. Another method can bring RNA capable of partially regulating or blocking the expression of an altered gene.
  • The nucleic acids are introduced into the patient's cells by means of a viral vector or injected directly into the cells in the form of naked DNA.
4 0
3 years ago
Read 2 more answers
Describe the characteristics of archaebacteria.
4vir4ik [10]

Archaebacteria are obligate anaerobes, i.e., they flourish in the strict absence of oxygen., and that is why only they can undergo methanogenesis.

The cell membranes of the Archaebacteria are composed of lipids.

The rigid cell wall provides shape and support to the Archaebacteria.

8 0
2 years ago
Other questions:
  • The best term to describe the general process by which microorganisms cause diseases is known as
    5·1 answer
  • What determines the fate of a star? a) The star’s age b) The star's mass c) The star’s position in the galaxy d) The star’s colo
    13·1 answer
  • Very cold periods in earths history resulted in which of the following?
    15·2 answers
  • What is the code that is used in mRNA
    5·2 answers
  • The prevailing weather conditions in any given area are called the
    12·1 answer
  • Why are cells called the building blocks of an organism?
    15·1 answer
  • A physician has a patient with diabetes. Due to a mutation in the patient’s insulin gene, he does not make the insulin protein.
    14·1 answer
  • Please help me with these 2 ?!
    14·1 answer
  • Why do plants look green?
    10·2 answers
  • Natural Selection results in -
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!