1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
10

Please I need help with this

Biology
1 answer:
barxatty [35]3 years ago
6 0
TAAGCCGATAAATGCTAACGGTA
You might be interested in
Label the drawing to the right
larisa86 [58]

Answer:

The three processes from left to right are:

<u>Replication</u>   DNA  <u>Trancription</u>  RNA  <u>Translation</u> Protein

Explanation:

The process in question in the diagram is called the central dogma of life which describes the flow of genetic information from DNA to RNA to Protein. The three processes involved are:

  1. DNA Replication
  2. Transcription
  3. Translation

DNA Replication:

DNA replication is the process by which DNA makes a copy of itself. Replication of DNA is semi-conservative. this means that each new helix is a combination of an old (parent) strands and a new (daughter strand). The parental strand is used as a template to generate a complementary daughter strand.

Transcription:

Transcription is the formation of an RNA transcript of the DNA template. This process yields a mRNA that is further used as a code to manufacture proteins in the process of translation.

Translation:

Translation decodes the mRNA formed in transcription to generate proteins with specific amino acid sequence.  

7 0
3 years ago
Why are archaea in a different domain from bacteria apex?
mariarad [96]
The archaea are in a different domain from bacteria due to certain differences in their morphology and habitats, the Archaea are the separate domain of life in prokaryotes. For example; unlike bacteria, archaea cell walls do not contain peptidoglycan, they have different membrane lipid bonding from bacteria and eukarya.
Archaea is  considered as the different domain of life in prokaryotes, as they are the most primitive type and known as the ancient microbes found in extreme niches such as hydrothermal vents, higher salt concentration, high temperature, and pressure etc
3 0
3 years ago
Read 2 more answers
Did I bleed through my pants
Stels [109]

Answer:

its possible

Explanation:

8 0
3 years ago
PLEASE ANSWER THIS ASAP!
Artyom0805 [142]

Answer:

w

Explanation:

3 0
3 years ago
Francis was recording plant heights for an experiment. Each time that she took a measurement, she wrote it down. Then,
Fittoniya [83]

Answer:

Form a conclusion

Explanation:

I believe this because they others don't make sense I'm sorry if it's in correct

8 0
4 years ago
Read 2 more answers
Other questions:
  • A 12-ounce can of pure __________ would contain more than enough to kill an adult.
    6·2 answers
  • The process by which organisms keep their internal conditions fairly constant is called?
    5·1 answer
  • What kind of cells does budding take place in?
    7·2 answers
  • Which best explains how the human body energy from food?
    8·1 answer
  • Please answer ASAP
    5·1 answer
  • Three phases of interphase
    7·1 answer
  • Elements are placed into the same period on the periodic table of the elements because they ___________.
    5·1 answer
  • 3 Consider this representation of an original DNA sequence: THE TALL MAN WAS SAD. Now consider the mutated sequence: THE TALL MA
    9·2 answers
  • PLEASE HELP ME<br><br><br> Use the following map and Key to find the elevation for all the points.​
    10·1 answer
  • How might compound leaves and leaves with lobed margins be well-suited to windy environments?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!