1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
10

Please I need help with this

Biology
1 answer:
barxatty [35]3 years ago
6 0
TAAGCCGATAAATGCTAACGGTA
You might be interested in
What is the approximate minimum stream velocity needed to keep a 6.4 cm diameter particle in motion?
Rashid [163]
A minimum stream velocity <span>needed to keep a 6.4 cm diameter particle in motion must be 100 cm/s.

It can be concluded from Hjulstrome curve, a graph used to determine whether stream will transport, erode or deposit particles. The faster is the current, the heavier particles it could transport.</span>
4 0
3 years ago
What are the two nutrients that start to be digested in the mouth and stomach?
s2008m [1.1K]

Explanation:

carbohydrates and proteins

7 0
2 years ago
2.)
wlad13 [49]
Answer: C-G-A will produce Arginine.

This can be shown in an amino acid codon chart :)
8 0
2 years ago
Which of the following pairs work together to form the neuroendocrine
Sphinxa [80]

Answer:

D

Explanation:

The neuroendocrine system is made up of the cell in the body that ‘sit’ between the nervous system and the endocrine system. These cells are like the pituitary gland, islets cells of the pancreas, thyroids, and etcetera. They receive nerve impulses  from nerves connected to them. The impulse then triggers them to release respective hormones into the blood.

8 0
2 years ago
Read 2 more answers
What are three ways body systems work together to maintain homeostasis?
mafiozo [28]

Answer:

Each organ system performs specific functions for the body, and each organ system is typically studied independently. However, the organ systems also work together to help the body maintain homeostasis.

For example, the cardiovascular, urinary, and lymphatic systems all help the body control water balance. The cardiovascular and lymphatic systems transport fluids throughout the body and help sense both solute and water levels and regulate pressure. If the water level gets too high, the urinary system produces more dilute urine (urine with a higher water content) to help eliminate the excess water. If the water level gets too low, more concentrated urine is produced so that water is conserved. The digestive system also plays a role with variable water absorption. Water can be lost through the integumentary and respiratory systems, but that loss is not directly involved in maintaining body fluids and is usually associated with other homeostatic mechanisms.

Similarly, the cardiovascular, integumentary, respiratory, and muscular systems work together to help the body maintain a stable internal temperature. If body temperature rises, blood vessels in the skin dilate, allowing more blood to flow near the skin’s surface. This allows heat to dissipate through the skin and into the surrounding air. The skin may also produce sweat if the body gets too hot; when the sweat evaporates, it helps to cool the body. Rapid breathing can also help the body eliminate excess heat. Together, these responses to increased body temperature explain why you sweat, pant, and become red in the face when you exercise hard. (Heavy breathing during exercise is also one way the body gets more oxygen to your muscles, and gets rid of the extra carbon dioxide produced by the muscles.)

7 0
2 years ago
Read 2 more answers
Other questions:
  • Periods of long term colder temperatures and expansion of polar ice sheets and glaciers is called
    5·1 answer
  • 1.What are examples of producers, primary consumers, secondary consumers, and tertiary consumers?
    7·1 answer
  • Results of air pollution
    13·1 answer
  • Sod sales have historically decreased during recessions. true or false
    6·1 answer
  • Sisoisjshsbshhshshsdhhdjsnsjsj
    8·1 answer
  • Extracellular calcium ions are important for the contraction of what type(s) of muscle tissue?
    8·1 answer
  • In which of the following taxa does the mature sporophyte depend completely on the gametophyte for nutrition?
    5·1 answer
  • HELP.. _____ immunity occurs when a person's immune system responds to an<br> antigen.
    11·1 answer
  • The Moon's orbit of Earth is due to the attractive forces explained by Newton's Universal Law of Gravitation. What
    14·1 answer
  • In the diagram below, which part of the human brain handles processes such
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!