1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
10

Please I need help with this

Biology
1 answer:
barxatty [35]3 years ago
6 0
TAAGCCGATAAATGCTAACGGTA
You might be interested in
The final step in the hybridization of radioactive DNA and normal DNA is to:
fgiga [73]

Answer:

B

Explanation:

Cooling reduces the excitement of the molecules of the DNA hence allowing the hydrogen bonds between the base pairs of the two strands to form hence the DNA is considered to anneal. Heating disrupts the hydrogen bonds and causes the two strands to dissociate.

3 0
3 years ago
A single older adult who has been losing weight involuntarily may benefit from
anygoal [31]

A single older adult who has been losing weight involuntarily may benefit from participation in a congregate meal program.

 

To add, Congregate<span> and Home Delivered Meals is an individually designed service which provides meals to waiver participants who cannot prepare or obtain nutritionally adequate meals for themselves.</span>

6 0
3 years ago
Read 2 more answers
Unattached microbes are moved from the lungs to the epiglottis by the _______ effect.
lisov135 [29]

Answer:

The unattached microbes are moved from lungs to epiglottis by the <u>mucociliary escalator effect.</u>

Explanation:

Mucociliary escalator, also known as mucociliary clearance, is one of the major defense mechanisms that protects the lungs. It describes the self-cleaning mechanism of the bronchi which are present in the lungs. The effectiveness of this mechanism depends on the properties of the produced mucus and on the quality and number of the cilia present in the lining of the airway.

Therefore, the unattached microbes are moved from lungs to epiglottis by the <u>mucociliary escalator effect.</u>

4 0
3 years ago
Which element is essential to making up all organic molecules?.
goldenfox [79]

Answer:

This element is carbon.

Explanation:

You might be quick to think the answer is something like hydrogen and oxygen because both form to make water. But understand that the question is not asking about important elements in life, just which element makes up organic molecules. This element happens to be carbon.

It's important to understand that carbon is lucky in that it has 4 valence electrons and is able to bond with other important elements, like F, N, and especially H. The bond between C-H is essential in organic chemistry because it represents the structure of an organic molecule and helps with the IUPAC naming of organic molecules. It also suffices to say that there is a cycle for carbon in the carbon cycle, which transports carbon from one place in our world to the other.

So, it suffices to say that carbon is in fact essential for making up organic molecules.

5 0
2 years ago
How will climate change affect the frequency of droughts and heat waves in the
mel-nik [20]
Are there answer choices or do you just need an answer?
6 0
2 years ago
Other questions:
  • What happens to the liquid in wastewater at a wastewater treatment plant?A. It is released into a river, lake, or ocean.B. It is
    15·2 answers
  • Why a entrophic body of water has high biological productivity
    8·1 answer
  • Explain why a combination of x-rays, ct scans, bone scans and mri scans is used when diagnosing bone cancer.
    15·1 answer
  • This is a series of biochemical reactions in photosynthesis that do not require light to proceed and produce the organic molecul
    8·1 answer
  • ¿Qué es la Cordillera del Atlántico Medio?​
    15·1 answer
  • What do you put on the bottom of a branching tree
    13·1 answer
  • What was “black Monday ” ? How did “black Monday” affect the direction of wilkin’s career?
    5·1 answer
  • How do organisms affect biodiversity in an ecosystem?
    14·1 answer
  • This organism must consume other organisms to obtain its energy
    7·2 answers
  • 2. Understanding human strengths is a focus of which kind of psychology?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!