1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavel [41]
3 years ago
12

Greg wrote the following steps in the formation of sedimentary rocks.

Biology
1 answer:
Lubov Fominskaja [6]3 years ago
6 0

the step in step 2 is wrong

You might be interested in
A pure-bred normal tail, dark skin, smooth skin mouse is crossed to a pure-bred mouse that is tail-less, pale skin, and rough sk
Ivanshal [37]

Answer:

TTppRR will produce TpR gametes.  ttPPrr  will produce tPr gametes.

Explanation:

Let us assume:

Normal tail : T, Tail less : t, Pale skin : P, Dark skin : p, Smooth skin : R, Rough skin : r

A pure-bred normal tail, dark skin, smooth skin mouse and a pure-bred mouse that is tail-less, pale skin, and rough skin  crossed together then,

TTppRR x ttPPrr

One allele from every gene comes in a gamete thus, TTppRR will produce TpR gametes.  ttPPrr  will produce tPr gametes.

5 0
3 years ago
In a dihybrid cross, the F2 will have nine genotypes, but only four phenotypes because the (Homozygous, Heterozygous) genes caus
Oksi-84 [34.3K]

SOS:

The answers is:

In a dihybrid cross, the F2 will have nine genotypes, but only four phenotypes because the <u><em>Heterozygous</em></u> genes cause the <u><em>Dominant</em></u> traits to mask the <u><em>Recessive</em></u> traits.

<em>Hope this helps!</em>

(Please rate Brainliest!)

5 0
3 years ago
Read 2 more answers
Select all that apply.
UNO [17]
I believe the answer is it can form polymers like carbs, lipids, proteins, and nucleic acids.
7 0
3 years ago
Read 2 more answers
Which phrase best describes what a soil horizon is? Question 3 options: the bottom layer of a soil profile each layer of a soil
IRINA_888 [86]
The place where two soil profiles meet i believe!
3 0
3 years ago
Distinguishing the Domains of Life
vitfil [10]

Answer:

1) Organisms in this domain can be unicellular or multicellular - Eukarya

2) Organisms in this domain are unicellular and are often found in extreme environments - Archaea

3) Organisms in this domain have cells that contain a nucleus - Eukarya

Explanation:

All living organisms were classified into a large group consisting of three types of organisms called DOMAIN. It is the highest taxonomic rank of organisms. The three domains that life was classified into are: Archaea, Bacteria and Eukarya.

The domain Archaea contains organisms that are unicellular and prokaryotic i.e. they do not have a membrane-bound nucleus. The organisms in this domain are characterized by their ability to survive in harsh environmental conditions e.g hot temperatures etc

The domain Bacteria also consists of unicellular and prokaryotic organisms. They contain cell walls in their cells made up of peptidoglycan unlike domain Archaea and Eukarya.

The domain Eukarya consists of organisms that are both unicellular and multicellular and strictly eukaryotic i.e. possess a membrane bound nucleus that houses their genetic material. They are divided into Kingdoms: Protista, Plantae, Animalia and Fungi.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Dinoflagellates are common endosymbiosis of which organisms?
    12·1 answer
  • When an enzyme denatures which bonds are destroyed?
    6·1 answer
  • I am shiny. I form +1 ions. There's more!
    10·2 answers
  • What is an ecosystem with an evenness of species numbers considered to be?
    12·1 answer
  • The law of supply and demand states that the greater the demand for a limited supply of something?
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What determines the function of a specialized cell?
    10·1 answer
  • What are DNA and RNA are made of?
    14·1 answer
  • How do some chemicals increase the risk of a person getting cancer ?
    15·2 answers
  • True or false?Metamorphism means” a change in form”
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!