1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonja [21]
3 years ago
7

Which of the following is carried out in the Golgi apparatus of the cell?

Biology
1 answer:
ycow [4]3 years ago
5 0
The answer is Protein synthesis. hope this helps.
You might be interested in
Why does frozen water (ice) float on liquid water
Natali5045456 [20]

Answer:

Because it is a solid that has trapped air with the water molecules in cold temperature thus creating a hard solid.

8 0
3 years ago
Read 2 more answers
What is a suspension solution????????????????
lana66690 [7]
A suspension is a heterogeneous mixture in which solute-like particles settle out of a solvent-like phase sometime after their introduction.
7 0
3 years ago
_____________ can change based on the force of gravity on an object.
liberstina [14]

Answer:

A mass

Explanation:

I learned it in 8th grade.

6 0
2 years ago
Read 2 more answers
Which enzyme is responsible for creating the covalent bonds that connect the sugar phosphate backbone of the new DNA molecules?
cupoosta [38]
DNA ligase <span>s responsible for creating the covalent bonds that connect the sugar phosphate backbone of the new DNA molecules</span>
5 0
2 years ago
Read 2 more answers
What is the value of numC at the end of this loop? numC = 12 while numC &gt; 3: numC = numC / 2 numC =
klio [65]

Answer: 3

Explanation:

Given :

numC = 12

while numC > 3:

numC = numC / 2

Initial value of numC = 12

The condition checks if the value of numC is greater than 12, only then will the statement be executed and the loop isn't altered

numC = 12 is greater Than 3 ;

numC = numC/2 = 12/2 = 6

numC is now 6 ;

numC = 6 is greater than 3

numC = numC / 2 = 6/2

numC is now 3

numC = 3 is not greater than 3 ; hence, loop terminates (condition isn't met)

Hence , numC = 3

3 0
3 years ago
Other questions:
  • Two heterozygous purple-flowering pea plants are crossed. If purple is dominant over white, what are the expected phenotypic res
    7·2 answers
  • Sir charles sherrington observed that impulses took an unexpectedly long time to travel a neural pathway. his observation provid
    5·1 answer
  • In both mitosis and meiosis___ must occur for the process to continue to completion
    11·1 answer
  • Proteins have a variety of functions within a living cell. Describe at least three of the possible functions of proteins, and ex
    11·2 answers
  • Andrea works in an office where frequent outbreaks of colds and viruses occur. However,andrea stays healthy most of the time and
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which two molecules do green plants use to make glucose
    5·2 answers
  • Please help!! Im gussing it’s either Y or Z
    8·1 answer
  • which of the following is NOT an acceptable name for the Golgi? A. complex. B.mechanism C. apparatus
    7·1 answer
  • How many cells in in human body?​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!