1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tasya [4]
3 years ago
5

Johannes wants to know whether soil, water, or both are needed for plant growth. He chooses to conduct experiments on a willow t

ree for five years to answer his question. How can his experimental methods be changed to improve his experiment?
Biology
2 answers:
muminat3 years ago
7 0

Johannes wants to know whether soil, water, or both are needed for plant growth. He chooses to conduct experiments on a willow tree for five years to answer his question. His experimental methods can be changed by testing more factors in the environment. This will improve his experiment.


<span>I hope it helps, Regards.</span>

Katarina [22]3 years ago
4 0

Answer : He needs to use a larger sample size to improve his experiment.

Explanation : As Johannes wants to know whether soil, water, or both are needed for plant growth. He chooses to conduct experiments on a willow tree for five years. To get the improvement in his experimental methods he can choose a larger size of the sample and test its results. As larger size will allow him to gauge accurately on the smaller factors and results will be more reliable. Larger sampling will ensure the homogeneity of the test sample, which will yield better and reliable results.

You might be interested in
1) Write the characters of 'Penguin' with the help of classification chart.
Svetach [21]

Explanation:

hope help you stay happy

5 0
2 years ago
The capsid and docking proteins function in three ways to help the virus attack the host cell. The functions include all BUT
Over [174]
B>encodes the genetic message for the synthesis of new proteins<span>
</span>
6 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Streptomyces griseus produces the antibiotic Streptomycin, which inhibits protein synthesis by binding to ribosomes and preventi
VLD [36.1K]

Answer:

See the answer below.

Explanation:

Antibiotic-producing bacteria are generally known to have a mechanism that enables them to be resistant to their own antibiotics. The mechanism that enables them to be resistant to their own antibiotic depends largely on the mode of action of the antibiotic substance.  

Some of the popular mechanisms used by bacteria to counter their own antibiotic substance include a mutation in the target gene, production of enzymes that inactivate the antibiotic compounds, or efflux of the compounds.

<u>In the case of </u><u><em>Streptomyces griseus</em></u><u>, the inactivity of streptomycin has been linked with the production of a phosphatase inhibitor that prevents streptomycin from getting access to the target site. Hence, the organism is not harmed by its own antibiotic.</u>

7 0
3 years ago
Gunter is going to have a medical test next week to capture changes in his brain activity. the technique reveals patterns of blo
Paul [167]

Gunter will be undergoing functional Magnetic Resonance Imaging (fMRI).

This technique for brain activity measuring is based on the fact that cerebral blood flow and neuronal activation are coupled. Blood flow increase in an area of the brain that is in use.


5 0
3 years ago
Other questions:
  • Which is associated with low humidity <br>dry air <br>warm air<br>rainforest<br>coastal area<br>​
    7·2 answers
  • How do ribosomes and the cell membrane work together?
    10·1 answer
  • The main difference between commercial and noncommercial operations is
    15·1 answer
  • Some populations of the world, like Africa's, have high fertility rates of over 7.0. Explain one factor that contributes to this
    6·1 answer
  • Which of the following organelles uses carbon dioxide to produce sugars (glucose)?
    13·1 answer
  • A student observes that a fallen Bryophyllum leaf has tiny plants growing along the leaf margin, as
    10·1 answer
  • Why are they called amino acids?
    5·1 answer
  • I need help with this ​
    15·1 answer
  • A fern is a seedless vascular plant because it has vascular ____ that transports water, nutrients, and food throughout the plant
    7·1 answer
  • Hemophilia is an X-linked recessive trait. Using the genotypes above, complete a
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!