Genotype - RR - 25%, Rr - 50%, rr - 25% (1:2:1)
Phenotype - Round seeds - 75%, Wrinkled seeds - 25% (3:1)
<h3>How explain your answer?</h3>
Let the letter "r" stand for the alleles, where R is round seeds and r is wrinkled seeds. A genotype is an individual's genes represented through alleles. Phenotypes are how the genes express themselves. In other words, genotypes will be written using letters, the alleles, and phenotypes will be the possible outcomes of the alleles.
Both of the parent seeds have the genotypes Rr and the phenotype of round seeds.
If you create punnet square (which had four boxes in total) 1 will have RR, 2 will have Rr, and 1 will have rr. These are the ratios for the genotypes. Each box represents 25%, so the percentages will be 25, 50, and 25. Finally, 3 of these boxes (RR and Rr) will result in round seeds because those are dominant. Only the genotype rr will result in wrinkled phenotype. Therefore, the ratio is 3:1 or 75% to 25%.
Thus, this could be the answer.
To learn more about genotypes and phenotypes click here:
brainly.com/question/20730322
#SPJ1
True these are both examples of food produced through alcoholic fermentation
Nucleic acids (DNA and RNA) are the only known molecules that are able to store genetic information and transmit genetic information (copy it and pass it on). They are found in all living things on Earth.
-Agarvated
Answer:
107 m/s
Explanation:
speed = distance / time taken
speed = 0.914 / 0.00854
speed = 107.0357 m/s
round off ( 107.0357 ) = 107 m/s
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
