1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
weeeeeb [17]
3 years ago
6

How does tears defend the body against infection

Biology
1 answer:
Irina-Kira [14]3 years ago
3 0

They help to protect us against invading pathogens. You have beneficial bacteria growing on your skin, in your bowel and other places in the body (such as the mouth and the gut) that stop other harmful bacteria from taking over.


Plz mark as brainliest

You might be interested in
Question 3
Andreyy89

Answer:

Plate boundaries

Explanation:

earthquakes move tectonic plates and plate boundaries

4 0
3 years ago
Which 2 processes are directly responsible for the growth and development of a butterfly?
Dima020 [189]

Answer:

development, growth and reproduction that a living thing goes through.

Explanation:

A life cycle refers to the stages of development, growth and reproduction that a living thing goes through. Every butterfly goes through four stages of development: (1) egg, (2) larva, (3) pupa and (4) adult. This process of development is called metamorphosis.

7 0
3 years ago
What you eat, I mix food with chemicals made by your body, then I churn up your food into smaller parts. What am I?
vazorg [7]

Answer:

Chemical digestion involves the secretions of enzymes throughout your digestive tract. These enzymes break the chemical bonds that hold food particles together. This allows food to be broken down into small, digestible parts.

H

4 0
3 years ago
When fat comes in contact with sodium hydroxide it produces soap and glycerin. Determine wheather this is a physical change or a
navik [9.2K]

Answer:

Chemical Change

Explanation:

2 new products emerge

6 0
3 years ago
A substance that is made of atoms of more than one type bound together is called a(n) ____________________ .
mario62 [17]
<span>A substance that is made of atoms of more than one type bound together is called a <span><u>compound</u>.
</span>A compound is a</span><span> substance consisting of atoms or ions of two or more different elements in definite proportions joined by chemical bonds into a molecule. </span><span>
</span>
4 0
3 years ago
Other questions:
  • ·supports and protects ·
    11·2 answers
  • Are red giants hotter than white dwarfs?
    10·1 answer
  • The scientific name for a white oak is Quercia Alba; the scientific name for a red oak is Quercia Ribera what does this tell you
    12·1 answer
  • Why arteries have thick and elastic muscular walls?
    8·1 answer
  • DO all organisms share the same genetic code
    12·1 answer
  • How are the light-dependent and light-independent reactions of photosynthesis related?
    13·1 answer
  • Identify the parts of the sun labeled A,B,C,D, and E
    5·1 answer
  • Identify the plankton
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • How can the rate at which bacteria are evolving to be antibiotic resistant be slowed down by humans?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!