1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
3 years ago
13

Select the correct answer from each drop-down menu. A population of frogs inhabits a lake. If the resource availability of the l

ake changes, the population may to use the resources that are available. As a result, the population would exhibit .
Biology
1 answer:
cupoosta [38]3 years ago
5 0

Answer: Intraspecific competition

Explanation:

Intraspecific competition is a type of competition that occurs among organisms of the same species due to limited food resources.

Thus, the decline in available resource of the lake make frogs practice Intraspecific competition

You might be interested in
What kind of energy heats our water?
Dominik [7]
Hi,

Any kind of energy can heat our water because to make any liquid object heat you need energy.
3 0
3 years ago
Read 2 more answers
Which example is the best description of an adaptation?
Liono4ka [1.6K]

A characteristics that helps an organism to survive and reproduce is the best description of an adaptation.  

Option D

<u>Explanation</u>:  

Adaptation is simply defined as the evolutionary process of the organism when they feel comfortable to their natural place of existence. The process takes place in many generation to generation and it is passed on with genetic inheritance. With its biological phenomena it explains a trait in organisms which helps animal to survive and reproduce. It is also process of changing to different places for the organisms. Adaptation happens through mutation or natural selection.

4 0
3 years ago
Rosa drew a flow chart of the carbon cycle.
ioda

Answer:

X: Producers undergo photosynthesis;

Y: Decomposers return carbon to the soil and release waste

Explanation:

Producers, for example, a clover, will take the CO2 in the atmosphere and use it in photosynthesis to turn it into nutrients, then the consumers, for example, a deer, will eat the producer to gain nutrients. After the consumer dies, the decomposer, for example, fungus, will eat away at the consumer, releasing CO2 into the atmosphere. Then the cycle keeps going.

7 0
3 years ago
Read 2 more answers
The graph is steeper between 1900 and 1905 than between 1905 and 1927. What does the steepness of the line
Mekhanik [1.2K]
Is there an imagine??
6 0
3 years ago
Suppose that you are able to sequence a portion of Dr. Ogden's genome. The DNA sequence below is a stretch of one of the genes.
icang [17]

Answer:

huh

Explanation:

fam what is that

3 0
3 years ago
Other questions:
  • Categorize the examples of competition between organisms as interspecific or intraspecific.
    11·2 answers
  • Fungi cannot make their own food through photosynthesis. How do they take in nutrients?
    6·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • If you take 40 pounds of luggage with you on a vacation and you buy 10 pounds of souvenirs for your family (because you're reall
    7·1 answer
  • Which of the following are types of autotrophs?
    11·1 answer
  • Whole grains are considered a good source of carbohydrates.<br> a. true<br> b. False
    14·2 answers
  • Write a paragraph using complete sentences about whether or not you think humans should establish an outpost on the Moon and the
    9·1 answer
  • A man with blood group B marries with a woman with blood group AB and the daughter has blood group AB. Is this information enoug
    13·1 answer
  • What type of rock is this new island made from?
    14·2 answers
  • Uh Oh!<br><br> Hold on, our servers are swamped. Wait for this question to fully load.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!