1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kkurt [141]
3 years ago
10

Why do complex carbohydrates, proteins, and fats decrease when the other molecules increase?

Biology
2 answers:
grigory [225]3 years ago
8 0

Answer:because the fat is more the carbohydrates so it will increase

Explanation:

bija089 [108]3 years ago
6 0

Answer:

hi how r u are u fine i am fine an u hehehe

You might be interested in
What type of bonding allows for cohesion and adhesion?
Korolek [52]
Hydrogen bonds allow for cohesion and adhesion. Think water properties
6 0
3 years ago
What is the dorsal surface called in four legged animals?
lora16 [44]
The dorsal surface in for legged animals is called superior
3 0
3 years ago
Which two natural resources will be most affected as people try to meet the growing demand for food
Fudgin [204]

Land and water are the two natural resources will be most affected as people try to meet the growing demand for food.

Meeting the growing demand for food will involve planting more food crops and this will requires more lands. The planted crops will also need water in order to grow very well. Thus, more land and water will be needed to produce more food.


7 0
3 years ago
What happens to the total population when the birth rate is at 40 and the death rate is at 15?
Trava [24]

If the birth rate in a population is 40, and the death rate in that population is 15, then the population will be experiencing growth. The growth will be 25 on every 1,000 people. If this trend continues for longer period, then the population will start to become younger and younger, making the basis of the population pyramid wider, while the top part of it smaller and smaller. This demographic situation in modern times seems to be present only in the less developed countries, with the majority of the transitioning countries having much decreased population growth, and the more developed countries having more deaths than births, thus being aging populations.

4 0
3 years ago
Read 2 more answers
If someone were researching the signs of the zodiac, what information would he or she want to include in the paper
olga2289 [7]
The year the person was born in chinese calendar or 黄历 if you know or u can look it up on the internet
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which organ loses about 5-10% of its weight by the time a person reaches 90 years of age? Lungs Brain Kidney Heart
    5·2 answers
  • Mountain building and rock formation are geologic ____.
    11·2 answers
  • Water is an important part of the biogeochemical cycles on Earth. Complete the sentences about water. In the water cycle, water
    7·1 answer
  • Which process takes place in meiosis but not in mitosis
    5·1 answer
  • In which phase of cell cycle does synthesis of DNA take place?
    13·2 answers
  • I have a simple question about external variables. If I'm doing an egg drop experiment, and my teacher "chucks" it off of the ro
    14·1 answer
  • Endosymbiotic theory in chronological order
    10·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Which part of the neuron below is indicated by the arrow, and what is its function?
    6·1 answer
  • Which of these best demonstrates mutualism between certain types of bacteria and<br> humans?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!