1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
3 years ago
12

Living organisms are made up of cells. Cells are organized at different levels to form very complex living organisms like your b

ody. Each level has a specific role or job to perform.
Which of the following lists these levels in the correct order of organization from the simplest to the most complex?
Biology
2 answers:
drek231 [11]3 years ago
7 0

Answer:

Look below :))

Explanation:

The highest level of organization for living things is the biosphere; it encompasses all other levels. The biological levels of organization of living things arranged from the simplest to most complex are: organelle, cells, tissues, organs, organ systems, organisms, populations, communities, ecosystem, and biosphere.

Thepotemich [5.8K]3 years ago
6 0

Answer:

The biological levels of organization of living things arranged from the simplest to most complex are: organelle, cells, tissues, organs, organ systems, organisms, populations, communities, ecosystem, and biosphere.

Explanation:

I hope it helped

You might be interested in
Examine the following mutation ACGGGCAAACGATTG -> ACGGGCUAACGATTG. The mutation is
allochka39001 [22]

Answer:

what da

Explanation:

7 0
3 years ago
Describe the microscopic features of osseous tissue that help long bones withstand stress without breaking.
frozen [14]
Compression and stretching are actually caused by the stress on the both.
Compression happens on the side of impact and Stretching happens ont he side opposite to that of the impact.
5 0
3 years ago
- Explain why the concept of evolution is a Scientific Theory.
Anni [7]

Answer:

The theory of evolution basically serves to explain the biological evolution of living beings. The theory of evolution basically serves to explain the biological evolution of living beings. This results in the appearance of new species different from the previous ones.

6 0
3 years ago
Read 2 more answers
Why do some children look more like their mother or more like their father?
baherus [9]

Answer:

The parents' part  DNA Is passed on to their Children, the genes get activated

on both the Mom and dad's. Some of the chromosomes are basically Copied from the parents. and that is what Makes the children Look more like their parents.

Explanation:

I hope this helps!

have a nice Day!

8 0
3 years ago
Every fall, clusters of hundreds of Danaus plexippus, or Monarch butterflies, migrate into Mexico. The traveling group of D. ple
cupoosta [38]
ANSWER: a.) population
4 0
3 years ago
Read 2 more answers
Other questions:
  • What are possible gametes produced by the individual ssyy
    5·1 answer
  • What 2 structures are found only in plant cells?
    7·2 answers
  • The circulatory system transports substances throughout the body. The diagram shown summarizes blood flow through the circulator
    12·1 answer
  • Which organelles are involved in energy conversion? (1 point)
    7·2 answers
  • A newly discovered solar system is found 600 billion kilometers from the sun. How many AU
    10·1 answer
  • Select all that apply.
    11·2 answers
  • 3. Is it possible that all elements of an Eco-system stay in balance with each
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • A football moves rapidly as it is thrown upwards. Its motion slows as it reaches a maximum
    11·2 answers
  • The faster an object moves, the
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!