1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
const2013 [10]
3 years ago
10

What might a scientist analyze?

Biology
1 answer:
jolli1 [7]3 years ago
4 0

Answer:

If there is one thing a scientist would analyze it would probably be all the factors in an experiment along with what the results.

Explanation:

Your question is too vague but I gave the most likely answer

You might be interested in
Are plates the same as continents?
victus00 [196]

Answer:

No

Explanation:

The tectonic plates make up the earth's crust. Continents are huge visible land masses.

7 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Decomposers make ______<br> available.<br> A. erosion<br> B. air<br> C. weathering<br> D. nutrients
bekas [8.4K]

Answer:

D

Explanation:

3 0
2 years ago
Read 2 more answers
Is grasshopper separation of oxygenated/Deoxygenated blood yes or no
MissTica

no because Separation of oxygenated and deoxygenated blood in the heart of three types of animals. The three-chambered frog heart mixes oxygenated and deoxygenated blood in the ventricle. Therefore, the body never receives fully oxygen-rich blood.

4 0
4 years ago
What might you find on a hiking trip around the bay?
Reil [10]
Nests, small organisms such as lizards, snakes, small birds, rock formations, skeletons of small animals.
4 0
3 years ago
Other questions:
  • When viewing an ap projection of the upper cervical spine open mouth technique you notice that the base of the skull is superimp
    13·1 answer
  • A petri dish is used to hold a specimen for viewing under a microscope.<br> true or false?
    7·1 answer
  • An ecologist observes that a population of plants in a meadow has flowers that may be red, yellow, white, pink, or purple. hypot
    14·1 answer
  • Sediment spreads horizontality and it goes from youngest on top to oldest on bottom. When sediment deposits in water, it also sp
    5·2 answers
  • What happens during the energy investment phase of glycolysis?a. Glucose is converted to 2 molecules of Glyceraldehyde 3-phospha
    7·1 answer
  • The average volume of a red blood cell is 87 μ m 3 . The mean concentration of hemoglobin in red blood cells is 0.34 g ⋅ ml − 1
    12·1 answer
  • Deep, cold water is the __________. Warm, shallow water is the ___________.
    8·1 answer
  • How do villi present in the small intestine increase the absorption rate?
    7·2 answers
  • What are 2 facts about energy?
    10·1 answer
  • Enzymes belong to the lipids family.<br> True<br> False
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!