To determine whether a cell is a eukaryotic or
prokaryotic cell, one can observe certain features.
If the cell in the question possesses a well-defined
or definite nucleus and have membrane-bound
organelles such as mitochondria, chloroplasts,
Golgi apparatus, endoplasmic reticulum, the cell is
eukaryotic. If the cell has nucleoid or indefinite
nucleus and without membrane-bound cell
organelles, the cell is prokaryotic. If ribosomes in
a cell are the 80S (S=Svedberg units) type, the cell
is eukaryotic and if ribosomes are 70S type then it
is prokaryotic.
Answer:
Widen Margins occurs at the continental margin in the pacific ocean, so the answer is:
1. Widened Margins.
Answer:
The image on the left is unicellular. Unicellular means to be made of one cell and the two on the right are multicellular, made of multiple cells.
Answer:
The start codon is AUG
Explanation:
A three nucleotide sequence (represented with bases) of a DNA or a RNA which translates to a specific amino acid is referred to as codon. To begin the translation into a new protein, the first three nucleotide is always AUG (called the START codon) which is the codon for methionine.
NOTE: AUG is the initial of the bases; Adenine, Uracil and Guanine
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
