1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
posledela
3 years ago
15

PLEASE PLEASE PLEASE HELP ​

Biology
1 answer:
nlexa [21]3 years ago
7 0

Answer:

i have no idea

Explanation:

becasue me in 6th

You might be interested in
What was known before Franklin and Wilkins conducted their studies of DNA? Check all that apply. DNA is found in the nucleus of
kvasek [131]

Answer:

The correct answer will be-

   1. DNA is found in the nucleus of a cell

    2. Organisms store and transmit genetic information

    3. Cells contain protein molecules.

Explanation:

The study of DNA started much before the discoveries of Rosalind Franklin and Maurice Wilkins.

Nucleus of cell was discovered by Robert Brown in 1831 but the material present inside the nucleus called "nuclein" (DNA) came from the studies of Johann Friedrich Miescher in 1869.

Proteins as a constituent of cell were discovered by the experimental analysis of Gerhardus Johannes Mulder in 1837.

DNA as a genetic material came from the experimental studies of Frederick Griffith in 1928, Oswald Avery, Maclyn McCarty, and Colin MacLeod in 1944, and Hershey and Chase in 1952.

Franklin and Maurice Wilkins are known for their work on the the structure of DNA as they were able to produce high-resolution X-ray photographs of DNA fibres called Photo 51 in 1952 using X-ray diffraction technique. By 1953 Franklin concluded concluded that DNA shows helical structure with phosphates on outer side.

Thus, 1. DNA is found in the nucleus of a cell

         2. Organisms store and transmit genetic information

         3. Cells contain protein molecules.

             are the correct options.

8 0
3 years ago
Read 2 more answers
Which process is the basis for the hierarchical organization of organisms?
zloy xaker [14]
A. cell division or <span>b. cell fractionation 
</span>
4 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
Can any one tell how to score Best in Boards​
mrs_skeptik [129]

Answer:

Create two instances of yourself, first is your present and the second one is your past. Now play a game between your Present and your Past.

Explanation:

Lol ur question doesn't make any sense sorry

6 0
2 years ago
Read 2 more answers
Describe three different types of evidence that scientists use to support the theory of evolution. Explain how each piece of evi
AlekseyPX

Answer:

1. Molecular evidence: similar proteins and genes found in closely related species, even if those genes are not used by an organism.

2. Fossil evidence: organisms changing form over time through the fossil record.

Direct observation. We can directly observe small-scale evolution in organisms

with short lifecycles (e.g., pesticide-resistant insects).

Explanation:

4 0
2 years ago
Other questions:
  • What is the name of the stage that precedes both mitosis and meiosis?
    12·1 answer
  • Sort each item into the appropriate bin based on which type of spectrum it represents.
    11·1 answer
  • If the root equi- means "equal," what does equinox mean?
    9·1 answer
  • Which of the following is not a possible cause for air pollution?
    13·1 answer
  • True or False: In human beings, fertilization occurs externally.
    9·1 answer
  • Choose all the answers that apply.
    15·1 answer
  • Helppppp will mark brainliest
    11·1 answer
  • Brainlist and 50 pnts for best anwser!! describe the main organs and components of the nervous system
    6·2 answers
  • The behavior that occurs when a wave travels straight through a medium is known as
    6·2 answers
  • Destruction of lymphocytes with self-specificity is called select one:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!