1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ierofanga [76]
3 years ago
15

Viruses do not have the ability to reproduce on their own, they need a blank

Biology
1 answer:
Georgia [21]3 years ago
8 0
The sentence should read "Viruses do not have the ability to reproduce on their own, they need a host cell"
You might be interested in
What are some interesting things about granite?
Oksana_A [137]

Answer:

Granite is like a mix of color and it looks nice amd modern, and marble is a nice clam looking thing.

3 0
3 years ago
Read 2 more answers
Microorganisms also exist in the fossil record, but they’re rarer than other types of fossils. The most common fossils form from
Usimov [2.4K]

Answer:

Organisms decompose more quickly when they are in contact with oxygen. ... When an organism is buried quickly, there is less decay and the better the chance for it to be preserved. The hard parts of organisms, such as bones, shells, and teeth have a better chance of becoming fossils than do softer parts.

Explanation:

3 0
3 years ago
Read 2 more answers
How can you control pollution arising from the need for manufactured goods?
MariettaO [177]
We can control pollution by 
(i)   By  Making workplaces no-smoking zones and banning cigarettes advertising.
(ii)   By Strictly penalties for consumers and firms who break the regulations.
(iii)  By Setting minimum standards in the workplace for health and safety.
4 0
3 years ago
Read 2 more answers
HURRY PLZ WILL GIVE BRAINLIEST
Anuta_ua [19.1K]

Answer:

Freedom of choice and action

6 0
3 years ago
Why are dissolved oxygen concentration is high in the surface waters of the ocean.
cestrela7 [59]

Answer:

oxegyen dissolves into the ocean from the atmosphere

Explanation:

The surface water is usually saturated with oxygen

6 0
3 years ago
Other questions:
  • Researchers tested the effects of acid rain on seedlings of two different species, camphor tree (cinnamomum camphora) and chinab
    11·2 answers
  • A reform in the Second New Deal that helped millions of retired Americans with financial difficulties.
    6·2 answers
  • In algae and plants, photosynthesis happens in the
    10·1 answer
  • Approximately what wavelength of light is best absorbed by chlorophyll a, the pigment that participates directly in the light re
    9·1 answer
  • How many valence electrons do elements in group 14 have
    12·1 answer
  • Why are genetic variation and selective breeding are advantages of sexual reproduction?
    8·1 answer
  • The variations in the features of the tortoise populations on Albemarle and Abingdon islands are examples of __________.
    10·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • 19. In the table, clearly mark the renewable resource(s).
    15·1 answer
  • Which of the following statements describing tre
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!