1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grin007 [14]
3 years ago
5

Question 4 of 15

Biology
2 answers:
GuDViN [60]3 years ago
8 0

Answer: D

Explanation:

Mediterranean sea touches the northern coast of Africa and the southern region of Europe.

Mashcka [7]3 years ago
5 0
D is correct. Hope it helps.
You might be interested in
4. Which is produced in cellular respiration? A. Carbon dioxide B. Oxygen C. Sugar​
Karolina [17]
That would be A. Carbon dioxide.


I hope this helped!

I would appreciate it if you gave me a thanks and brainliest mark (:
7 0
3 years ago
Read 2 more answers
The areas of the brain located just above the sinus cavity and just below the frontal lobes that receive information from the ol
crimeas [40]

Answer:

C) Olfactory bulb is a correct answer.

Explanation:

Olfactory blub role it to sense the smell once they receive the information from the olfactory receptor, it sends the information from the nose to the brain region.This process occurs when the odorants get bind to the olfactory receptors at the specific sites and the glomerulus is present on the olfactory bulb of brain region detects the signal from the receptor and transmit to olfactory blub, and then the brain interacts with the sensory parts, by this ways smell identification is done.

The areas of the brain located just above the sinus cavity and just below the frontal lobes that receive information from the olfactory receptor cells is known as the Olfactory bulb.

7 0
4 years ago
Which organs produces and secretes enzymes that are essential for proper digestion?
ollegr [7]

Answer:

An enzyme refers to a kind of protein found inside a cell. The enzymes result in the chemical reactions within the body. The function to accelerate the rate of chemical reaction in order to support life. The enzymes in the body assist in performing very essential functions. These comprise eradicating toxins, building muscle, and dissociating particles of food at the time of digestion.  

Enzymes are needed for performing the proper function of the digestive system. Digestive enzymes are primarily produced in the stomach, pancreas, and small intestine. However, even salivary glands generate digestive enzymes in order to dissociate the molecules of food at the time of chewing.  

There are three prime kinds of digestive enzymes, which are classified on the basis of the reactions they catalyze. These are protease, amylase, and lipase.  

3 0
4 years ago
Read 2 more answers
Consider these scenarios. Scenario A: Carmen reads an article in Tasty Food magazine stating that eating an apple can help you f
sineoko [7]

Answer: The article read by Yuki is more likely to have been peer-reviewed because this article is part of a Journal Medicine and peer-review is mandatory in most Academic journals before publication.

Explanation:

Peer-review implies academic works such as research papers or articles are verified by peers of the author. For example, a medical article is evaluated by other experts in the same field with similar knowledge and competences. This process is essential to guarantee the information is accurate and reliable.  Moreover, peer-review is used mainly in academic journals or academic papers. Indeed, most academic journals require new articles or papers to be peer-review before these are published in the journal.

In this context, it is likely the article red by Yuki has been peer-reviewed because this is part of a Medicine journal and it is a general standard for articles in journals to be reviewed. Also, this is not a requirement for articles published in regular magazines such as Tasty Food magazine.

6 0
3 years ago
Grizzly bears are omnivores that can eat up to 15 percent of
SOVA2 [1]

fish and berrys yummy lol

8 0
3 years ago
Other questions:
  • One of the key innovations in the evolution of eukaryotes from a prokaryotic ancestor is the endomembrane system. which eukaryot
    11·2 answers
  • The cell body of a neuron is called the ________.
    5·1 answer
  • The process in which two species interact in ways that benefit both of them is called
    13·1 answer
  • Why might the nucleus be referred to as the brain of the cell​
    13·1 answer
  • The hypothalamus sends messages through both the nervous system and the endocrine system.
    7·2 answers
  • Which formula would be used to find the measure of angle 1?
    8·2 answers
  • Is there anymore that you can do for your own bone maintenance? What actions would you take? Are you doing a great job of mainta
    8·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Why are trees not found in the chaparral?
    11·1 answer
  • Can you break a mixture of cornstarch and water?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!