1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anzhelika [568]
3 years ago
8

HELLLPPPPPP MEMMEMEMEME

Biology
2 answers:
Allushta [10]3 years ago
8 0
Answer: B. Kilograms
gladu [14]3 years ago
7 0

Answer:

B, Kilograms.

Explanation:

We can compare this to another problem, to help you understand.

Chase is a puppy and doesn't weight a lot. Let's review the different metric units that we use for measuring weight. A milligram is for very tiny things such as a bean or a dust particle. A gram measures slightly heavier things like a paperclip or a pencil. A kilogram is used for things with definite weight, like a kitten or a dog.

The vet would have measured Chase in kilograms.

Hope this helped. :)

You might be interested in
A glucose molecule could be used as an example of potential energy, why is this true? The chemical energy stored in the glucose
Fantom [35]
Since glucose really means "sugar", Sugar gives us energy and is also a necesity that our body needs to keep up.
3 0
3 years ago
Read 2 more answers
Name two mammals that might pollinate a plant
Nana76 [90]

squirrel and deer. Other animals could be elephants,monkeys, etc

3 0
3 years ago
Name the process responsible for the formation of glomerular filtrate<br>​
STatiana [176]

Answer: Please refer to:

The process by which glomerular filtration occurs is called renal ultrafiltration. The force of hydrostatic pressure in the glomerulus (the force of pressure exerted from the pressure of the blood vessel itself) is the driving force that pushes filtrate out of the capillaries and into the slits in the nephron.

Explanation:

Not sure but hope it helps.

4 0
3 years ago
Question 6
Alekssandra [29.7K]

Answer:

Meotic cell division (mitosis)

3 0
3 years ago
What are key markers for the identification of Bacteria?
Brut [27]

Answer

The key markers for the identification of bacteria are special RNA polymerase, peptidoglycan in cell walls. ester-linked fatty acids.  

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • What sre the proportions of clay, silt, and sand shown at point B in figure 5-1
    13·1 answer
  • Written response (answer with a paragraph): Explain how the functionalist perspective and the conflict perspective view the phen
    15·1 answer
  • It is important to remove any big air bubbles from the microtubes prior to incubation. Otherwise, the bubbles could:_______.
    5·1 answer
  • Like poisonous dart frogs, monarch butterflies are brightly colored. What might be adaptive advantage of bright coloration?
    11·2 answers
  • A local wetland was recently paved over to make a new retail center and amusement park. The wetland was home to a rare species o
    11·1 answer
  • What was produced as a result of the human genome project
    7·1 answer
  • What do you call a glitch in the DNA copying process?
    9·1 answer
  • A collection of closely related animals or plants that share a similar genetic evolutionary history but cannot necessarily inter
    12·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How many glycosidic bonds would be needed to combine three monosaccharides together?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!