1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Komok [63]
3 years ago
12

How does research on attributional processes help to explain the link between hot weather and aggression?

Biology
1 answer:
Neko [114]3 years ago
4 0
During a study in the U.S., it was noted that people are more violent during summer months and December. It is also disclosed that climate change could lead to more violence, as an example, during El Ni<span>ño, civil conflict increases. The reason is that anger increases the body temperature by increasing blood pressure and altering the distribution of blood in our body. Higher temperature means an increase in aggression and the heat triggers the feelings of anger.  </span>
You might be interested in
Proteins are assembled by which organelles
FinnZ [79.3K]
Proteins are made up of a chain of 20 amino acids
7 0
3 years ago
Can you please with this question?
Gre4nikov [31]

Answer:

deletion

Explanation:

AAC GGC AAA CGA TTG ---> ACG GGC AA? CGA TTG

The bolded portion represents where the mutation occured.

As you can see the nitrogenous base adenine was completely removed from the codon

When a nitrogenous base gets removed it is known as a <u>deletion </u><u>mutation</u>

6 0
3 years ago
Which Meteorite Condition in Space is Similar To What Most Likely Was Present On Early Earth?
gavmur [86]
I would say presence of inorganic molecules I THINK not sure.
3 0
3 years ago
Read 2 more answers
A condition exists which affects a persons ability to sweat normally. If the human body cannot sweat properly it is harmful beca
Stella [2.4K]
The body would not be able to cool itself so excess heat would remain in the body instead of being lost via evaporation of sweat. The rise in temperature would not be brought back to normal which would affect thermo-regulation in the body.
The high body temperature would most definitely affect the activity of enzymes in the body which control most metabolic reactions.
6 0
3 years ago
Supply-and-Demand Schedule for Cell Phones Price of Cell Phones Quantity Supplied of Cell Phones Quantity Demanded of Cell Phone
k0ka [10]

Answer:

$150, $200

Explanation:

A schedule that shows relationship between quantity supplied and quantity demanded is used to estimate the equilibrium quantity and price where there is a balance between the buyer's willingness to buy and the seller's willingness to sell.

Below this equilibrium point there is excess of quantity demanded over limited supply.

Above equilibrium there is excess supply and less demand.

According to the given schedule the equilibrium price is $100 where demand and supply are both 300 units.

The prices at which there are excess supply is given below

At $150 400 units is supplied against 250 units demanded

At $200 500 units are supplied against 0 units demanded

5 0
3 years ago
Other questions:
  • Which of the following is true of the light dependent reactions but not of the light independent reaction?
    7·1 answer
  • How do you calculate the eccentricity of an ellips?
    15·1 answer
  • How would you describe the differences between external respiration and cellular respiration?
    8·1 answer
  • If a cell divides by mitosis so that one cell eventually becomes part of the brain and the other cell becomes part of a salivary
    6·1 answer
  • Can someone explain to me what chromosomes are, and also explain briefly and understandably grade 10/ 10th grade biology term 1
    7·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • The gene for wing shape in fruit flies has two alleles; P codes for oval-shaped wings and p codes for heart-shaped wings. P is c
    15·1 answer
  • How does a rhinovirus cause symptoms of a common cold to spread in the
    9·2 answers
  • What is the correct order of electron transport compounds
    13·1 answer
  • A large, smooth, rounded articulating oval structure is called what?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!