1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlada-n [284]
3 years ago
8

Which environmental program is one that protects the supply of groundwater?

Biology
2 answers:
nexus9112 [7]3 years ago
7 0

Answer:

C. South American Guarani Aquifer System

Oksana_A [137]3 years ago
3 0

Answer: C South American Guarani Aquifer System

Explanation: I got it right in the quiz and lesson.

You might be interested in
If fertilization occurs which hormone triggers the thickening of the endometrium
Doss [256]

Answer: B. Progesterone

Explanation: trust me;)

8 0
3 years ago
The initiating event in the development of nephrotic syndrome is a derangement in the glomerular membrane that causes increased
makkiz [27]

The initiating event in the development of nephrotic syndrome is a derangement in the glomerular membrane that causes increased permeability to plasma proteins.

Nephrotic syndrome can be understood as a kidney disorder in which the glomeruli filter of the kidney gets damaged due to which it is unable to filter the proteins and passes an excess amount of protein in the urine.

Glomeruli filter consists of clusters of small blood vessels in the kidneys that function in filtering the waste and excess water from the blood. It also sweeps the blood protein which is necessary to maintain the correct amount of fluid in the body, from seeping into the urine. But when it gets damaged glomeruli stop sweeping the protein from the urine as a result too much blood protein leaves your body, leading to nephrotic syndrome.

Learn more about Nephrotic syndrome here

brainly.com/question/10125358

#SPJ4

5 0
2 years ago
If an organisms Haploid (Gamete) cell contains 34 chromosomes, how many chromosomes are in its Diploid (Somatic) cells?
ivolga24 [154]

Answer:

68

Explanation:

..................

8 0
3 years ago
A good web is represented in the diagram below. If the fish population decreases what is the most direct effect this will have o
Mekhanik [1.2K]
Can you show a picture of the question
4 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • The sub unit of a nucleic acid. Glycerol Nucleotide Saccharide Amino acid
    14·1 answer
  • Is neon different from oxygen?And how is it different? Please explain.
    14·1 answer
  • The biggest difference between the ROUGH endoplasmic reticulum and the SMOOTH endoplasmic reticulum,is that ER contains what?
    14·1 answer
  • What will happen if your body doesnt have skin
    10·2 answers
  • What can get cancer and what must it have in order to get cancer?
    7·1 answer
  • What is a nucleus in a cell
    8·2 answers
  • A(n)_______ is an individual created through asexual reproduction.
    5·2 answers
  • How do the cells in meiosis differ from the cells in mitosis?
    10·2 answers
  • Choose the stage that best matches the description given.
    8·1 answer
  • i’m tired of school and hate it and have no idea what i’m learning i don’t have any motivation on learning that and i cheat so w
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!