1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paraphin [41]
2 years ago
8

How many different amino acids are there that make up all of the proteins in our body

Biology
1 answer:
NNADVOKAT [17]2 years ago
5 0

Answer: billions of types of proteins

You might be interested in
Which one of the following viruses is an RNA virus?
Artemon [7]

Explanation:

HIV virus is an RNA virus

5 0
3 years ago
During a pertussis infection, the pathogenic bacterium Bordatella pertussis produces tracheal cytotoxin, which destroys cilia. W
fiasKO [112]

Mucus would most likely accumulate in the respiratory tract as a result of ciliary destruction.

Pertussis (whooping cough) is a highly contagious respiratory tract infection. A severe hacking cough is followed by the a high-pitched breath intake that sounds like "whoop" in many people. Before the vaccine, whooping cough was thought to be a childhood disease. Whooping cough now primarily affects children who have not received the full course of vaccinations, as well as teenagers and adults whose immunity has waned.

Deaths from whooping cough are uncommon, but most commonly occur in infants. That is why it is critical for pregnant women and others who will have close contact with an infant to be immunized against whooping cough. The best way to avoid pertussis is to get vaccinated. Check that you and your loved ones have received their pertussis vaccines.

To know more about the Pertussis, here

brainly.com/question/29436233

#SPJ4

5 0
1 year ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
A soccer player sustains a blow to the lateral aspect of the leg when the leg was planted. what anatomical structure in the knee
jonny [76]
Yuyyyyyydnnhbgg ghkoolkvjj
3 0
3 years ago
Fossils almost never contain DNA. So how can we know how closely or distantly related fossil organsims are to living organisms
Nostrana [21]
While it's true that Fossils hardly even contain DNA, they can still provide numerous clues in order to identify and verify an organism.

For example, in terms of Dinosaurs, their bones and fossils have provided enough evidence to provide an evolutionary link with modern birds.

Carbon dating is another way to find the age of a fossil which provides more information on it's surrounding habitat and the animals it interacted with.
6 0
3 years ago
Other questions:
  • For all questions, assume that you have genes for beak color, tail-feather length, and feather color all linked (located) on the
    5·1 answer
  • Which is not a characteristic of life?
    10·1 answer
  • True or false, the attraction of opposite charges between hydrogen and oxygen forms a weak oxygen bond
    5·1 answer
  • 11. The surface area of rocks exposed to
    15·1 answer
  • The nurse reviews a patient's laboratory values of digoxin level 10 ng/ml and value of serum potassium 6.2. which drug does the
    6·1 answer
  • First one that answers this question correctly will be marked Brainliest!!!!!!
    15·1 answer
  • The hypothalamus controls excretions from the pituitary gland. It causes the release of some hormones from the pituitary by dire
    10·2 answers
  • When an organism gets larger, the characteristic of life shown is
    13·1 answer
  • There are how many categories of symbiosis? <br> A. 3<br><br> B. 5<br><br> C. 10
    10·2 answers
  • Provide 1 example of how scientists have already used this technology?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!