1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sunny_sXe [5.5K]
3 years ago
11

Which term accurately describes the position of a gene on a chromosome?

Biology
2 answers:
Pavel [41]3 years ago
7 0
locus is the best term to describe the position of gene in the chromosome. so locus is that place within the chromosome where information about a certain trait is stored. to some extent locus is interchangeable with the term gene. homologous chromosomes have identical genes in the same loci.  
guapka [62]3 years ago
3 0
<span>Locus is the description of a position that determines the position of a gene on a chromosome. In biology, it is used to identify positions on certain sequences. This is the term used to describe this type of feature of a gene on a chromosome.</span>
You might be interested in
ILL MARK BRAINLIEST
oksano4ka [1.4K]
It has a thick atmosphere of hydrogen and helium
3 0
3 years ago
Read 2 more answers
Which is happening when humans control the breeding of living things to favor certain desired features?
astraxan [27]
That would be Artificial Selection.
4 0
2 years ago
Gravity on the moon is about 1/6th the gravity felt on the Earth. This is because
garri49 [273]
The moon has less gravity because it is smaller than the Earth.
8 0
3 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
situations in which one allele for a gene is not completely dominant over another allele for that gene are called....
stiks02 [169]
This is called incomplete dominance. When an something is heterozygous for an incomplete dominant gene, the resulting phenotype will be somewhere between the two. For example if a plant has a tall allele and a short one, but neither shows complete dominance over the other, the plant height will be somewhere in the middle.
7 0
3 years ago
Other questions:
  • What is a example of allele
    13·1 answer
  • John collected a sample of pond water to look for tiny living microorganisms. Which type of microscope does John need to use to
    9·1 answer
  • Mutations only occur in somatic cells. True or False?
    6·1 answer
  • Elongated, six-sided crystals are characteristic of which mineral?
    10·1 answer
  • In what way does a specialized cell in a multicellular organism differ from the cell of a unicellular organism
    11·1 answer
  • Which has a stronger force of gravity with the sun Earth or Mercury
    14·2 answers
  • Role of T helper cells in the specific immune response
    12·2 answers
  • HELPP PLEASEEEE FASTTTT
    8·2 answers
  • Which of the following motions causes day and night?
    9·2 answers
  • Which of these body systems transports glucose and other substances in the blood
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!