1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sunny_sXe [5.5K]
3 years ago
11

Which term accurately describes the position of a gene on a chromosome?

Biology
2 answers:
Pavel [41]3 years ago
7 0
locus is the best term to describe the position of gene in the chromosome. so locus is that place within the chromosome where information about a certain trait is stored. to some extent locus is interchangeable with the term gene. homologous chromosomes have identical genes in the same loci.  
guapka [62]3 years ago
3 0
<span>Locus is the description of a position that determines the position of a gene on a chromosome. In biology, it is used to identify positions on certain sequences. This is the term used to describe this type of feature of a gene on a chromosome.</span>
You might be interested in
Describe in a short paragraph how the following terms work together in an ecosystem and which of the terms can be used to includ
podryga [215]
Trophic level: the feeding level of an organism in a food web or chain. Food web: a diagram showing a series of interconnected food chains and the flow of energy through an ecosystem. Food chain: a diagram showing the flow of energy from one trophic level to the next. E.g. Consumer or decomposed Consumer: an organism which feeds on other organisms to obtain its nutritional requirements (part of a food web/chain). Producer: an organism capable of trapping the suns energy and converting it to sugar in the process of photosynthesis. Therefore the term food web is the term used to include all of the above. 
hope this helps, :)
4 0
3 years ago
Read 2 more answers
Name a organism that does most of the Earth’s nitrogen fixation for the nitrogen cycle
zmey [24]

Carbon fixation only takes place in autotrophs. For example plants, algae, and some bacteria, or organisms that make their own food.

4 0
3 years ago
Explain the environmental impacts potentially faced from global warming.
Serjik [45]
-Melting Icebergs, glaciers, and ice sheets
-sea level rise
-wildfire
3 0
3 years ago
What would happen if you did an experiment in which the iodine solution was placed in a baggie, and the starch solution was in t
Charra [1.4K]
The iodine would move out of the baggie and the starch would change color
5 0
2 years ago
What moderates much of the air temperature over northwestern Europe?
tester [92]
The North Atlantic drift is the moderator of the air temperature over northwestern Europe. It is generally warm and rotates clockwise.
3 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • 2. The Köppen classification system is used as a classification system for
    6·1 answer
  • Chemotherapy can cause severe nausea and an aversion to foods that might have been preferred foods prior to receiving this treat
    15·1 answer
  • Eduardo and Grace are discussing the nervous system. Eduardo says that the peripheral nervous system is made up of the spinal co
    11·1 answer
  • The DNA of a fly and the DNA of a gorilla are made up of subunits that are
    8·2 answers
  • Discuss the anatomical changes that occurred in the bipedal hominin and how they reflect certain habitat adaptations and then di
    15·1 answer
  • 2. Which of the following is a physical property of matter that is always the same regardless of size
    8·1 answer
  • Form a Hypothesis: As the map shows, the sickle cell allele is not found in African populations that are native to southern Afri
    15·1 answer
  • What are the two major types of genes responsible for cancer? What are their normal function
    6·2 answers
  • I WILL MARK YOU BRAINLIEST IF YOU ANSWER THIS.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!