Answer:
In physical appearance can be changed by different DNA but for mental not very sure.But mental state can be altered when the DNA has anomaly or mutation. Mostly, people whom has high education always study hard for example students even they have physical problem but they still have good mental
Answer:
Option B, They generally focus on one target insect to ensure that the target insect population remains low.
Explanation:
Biological pest control methodologies are focused towards a specific species of pest and do not harm the non-targeted species. These methods are environment friendly and do not produce any harmful residues. Also they do not develop any kind of resistance in species due to which the same bio pesticide can be used again and again. Since these methods have high specificity, they may require usage of two or more bio pesticides all together.
Hence, option B is correct
<span>Remember that of the three Domains, only Eukaryota have multicellular organisms. AllEukaryotes have (or are) complex cells. Plantae, Animalia and Fungi are truemulticellular kingdoms. The various other Eukaryotic kingdoms are lumped under Protists. Hope this helps</span>
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Index fossils (also known as guide
fossils, indicator fossils or zone
fossils) are fossils used to define
and identify geologic periods (or
faunal stages).
