I believe the answers are A. C. D.
Connected to the occipital bones
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
1-The longest a total solar eclipse can last is 7.5 minutes.
2-The width of the path of totality is usually about 160 km across and can sweep across an area of Earth's surface about 10,000 miles long.
3-Almost identical eclipses occur after 18 years and 11 days.
4-This period of 223 synodic months is called a saros.
5-Each year there are between 2 and 5 solar eclipses.
6-The total solar eclipse, when the Moon completely obscures the Sun and leaves only the faint solar corona, is known as a Totality.
7-Total solar eclipses are rare, happening only once every 18 months.
8-Total solar eclipses produce harmful rays that can cause blindness.
9-If any planets are in the sky at the time of a total solar eclipse, they can be seen as points of light.
10-During a total solar eclipse, conditions in the path of totality can change quickly. Air temperatures drop and the immediate area becomes dark.
11- A solar eclipse can only occur when the Moon is close enough to the ecliptic plane during a new moon
A.Osmosis occurs through a semi permeable membrane. Diffusion occurs in permeable membrane.
