Answer:
The correct answer is - option C.
Explanation:
Cultural diversity is the quality of the diversity or differences of the culture or society. It is important due to the various cultural and society or racial groups. It is learned by the one another. When it is confronted by environmental influences on behavior.
Thus, the correct answer is - option C.
The answer for this is legumes.
Answer:
Explanation:
Brachii: H - It means of the arm.
Palmaris: H - It means of the palm of hands.
Longus : G - Longus means long
Brachio: C - It refers to origin on the upper arm.
Radialis: C - It refers to insertion on the radius of the forearm.
Pronator: A - Pronation is inward rotation of part of the body towards middle of the body.
Teres: B - meaning round or cylindrical shape
Deltoid: B - meaning triangular shape
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
