1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rasek [7]
3 years ago
15

Water molecules attract other water molecules and tend to pile up via? Adhesion, vaporization, dissociation, cohesion

Biology
1 answer:
lyudmila [28]3 years ago
3 0
Cohesion is water sticking to water. adhesion is water sticking to another thing, think of it as you're adding something to the water molecules. add-hesion
You might be interested in
Describe one way osmosis and osmotic pressure is important to medicine.
OleMash [197]

Answer:

Since the beginning of life of the first multicellular organisms, the preservation of a physiologic milieu for every cell in the organism has been a critical requirement. A particular range of osmolality of the body fluids is essential for the maintenance of cell volume. In humans the stability of electrolyte concentrations and their resulting osmolality in the body fluids is the consequence of complex interactions between cell membrane functions, hormonal control, thirst, and controlled kidney excretion of fluid and solutes. Knowledge of these mechanisms, of the biochemical principles of osmolality, and of the relevant situations occurring in disease is of importance to every physician. This comprehensive review summarizes the major facts on osmolality, its relation to electrolytes and other solutes, and its relevance in physiology and in disease states with a focus on dialysis-related considerations.

3 0
2 years ago
1. first genus 2. second domain 3. third species 4. fourth family 5. fifth kingdom 6. sixth class 7. seventh phylum/division 8.
Klio2033 [76]

In order:

kingdom, phylum/division, class, order, genus, species

5 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
The two basic types of cells that all cells can be grouped under are
svet-max [94.6K]
The answer is prokaryotic cells and Eukaryotas.
7 0
3 years ago
Read 2 more answers
The pH of water is<br> because it contains an equal amount of HF and OH- ions.<br> 7<br> 9<br> 6
V125BC [204]

Answer:

7

Explanation:

water is neutral 7 is neutral ph

3 0
3 years ago
Read 2 more answers
Other questions:
  • What field of work has been most impacted as dna technology has improved?
    12·1 answer
  • What is the volume of a sample of water is the mass is 6.7 g?
    6·1 answer
  • When in the cell cycle does independent assortment of chromosomes occur?
    6·1 answer
  • The temperature around Earth's equator stays about the same throughout the year. Why does this happen?
    7·1 answer
  • What are the narrow belts of fast-moving air at the higher levels of the troposphere called? A. doldrums B. sea breezes C. hurri
    10·2 answers
  • The ability to resist interference from irrelevant information to stay focused on the task at hand is called:
    10·2 answers
  • What structure is located between the trachea and a bronchiole?
    8·1 answer
  • What is the most important organ in human body?
    8·2 answers
  • Moss gets buried and compressed overtime forming what
    5·1 answer
  • TRUE OR FALSE: MYCOBACTERIA IS A GROUP OF BACTERIA THAT USED TO BE CLASSIFIED AS ALGAE
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!