1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klasskru [66]
3 years ago
15

The excretory system rids the body of toxic chemicals, excess water, salts, and carbon dioxide while maintaining osmotic and ph

balance. which three organ systems combine to form the excretory system?
a. digestive system, muscular system, respiratory system

b. integumentary system, respiratory system, urinary system

c. circulatory system, endocrine system, integumentary system

d. circulatory system, digestive system, urinary system
Biology
1 answer:
MAVERICK [17]3 years ago
4 0

I feel like it would be b

You might be interested in
Which statement accurately describes the tissues indicated by the line in the microscopic image?
amid [387]
A. The connective tissues that protect the inside of the arteries and veins.
3 0
2 years ago
Description of a blue shark
Westkost [7]

The aerodynamic shape and lightness of the blue shark body allow it to move “elegantly” across the oceans. It exhibits countershading like many other sharks. The upper part is an indigo blue tone while the ventral and the sides are white.

It has a long caudal heterocercal fin. The second dorsal fin measures almost half the size of the first and its pectoral fins are unusually long compared to other sharks. Its eyes are large, its teeth are triangular, and it has a conical snout.

It reaches a length ranging from 3.8 to 4 meters and weighs about 240 kilograms. This species presents slight sexual dimorphism since the female tends to measure little more than 1 meter in comparison with the male.


5 0
3 years ago
What is the answer it is hard
Art [367]
Intake and eject

I hope it is correct
6 0
3 years ago
A donkey and a horse can be mated to produce a mule, but mules are sterile and cannot have
vazorg [7]

Answer:

But hinnies and mules can't have babies of their own. They are sterile because they can't make sperm or eggs. They have trouble making sperm or eggs because their chromosomes don't match up well. ... A mule gets 32 horse chromosomes from mom and 31 donkey chromosomes from dad for a total of 63 chromosomes

6 0
3 years ago
Read 2 more answers
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
Other questions:
  • Explain whether opening and closing your eyes is voluntary or involuntary
    7·1 answer
  • A body of granite was found to underlie sandstone. pieces of sandstone were found in the granite. which is younger, the granite
    9·1 answer
  • The cardiac cell at rest has what kind of electrical charge?
    5·1 answer
  • Which pair of statements best describes an essential amino acid?
    10·2 answers
  • Which statement about vacuoles is true
    14·1 answer
  • Which of the following statements about Ngb-H64Q is true?
    6·1 answer
  • In some chordates, pharyngeal slits develop into _____. choose one answer.
    15·1 answer
  • WHAT ENERGY RELATIONSHIP EXIST BETWEEN THE IMMATURE HERRING, ARROW WORMS, AND ADULT HERRING?
    5·1 answer
  • Which cell feature is responsible for making proteins?<br>​
    5·2 answers
  • When a human egg is fertilized, the sex
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!