A. The connective tissues that protect the inside of the arteries and veins.
The aerodynamic shape and lightness of the blue shark body allow it
to move “elegantly” across the oceans. It exhibits countershading like
many other sharks. The upper part is an indigo blue tone while the
ventral and the sides are white.
It has a long caudal heterocercal fin. The second dorsal fin measures
almost half the size of the first and its pectoral fins are unusually
long compared to other sharks. Its eyes are large, its teeth are
triangular, and it has a conical snout.
It reaches a length ranging from 3.8 to 4 meters and weighs about 240
kilograms. This species presents slight sexual dimorphism since the
female tends to measure little more than 1 meter in comparison with the
male.
Intake and eject
I hope it is correct
Answer:
But hinnies and mules can't have babies of their own. They are sterile because they can't make sperm or eggs. They have trouble making sperm or eggs because their chromosomes don't match up well. ... A mule gets 32 horse chromosomes from mom and 31 donkey chromosomes from dad for a total of 63 chromosomes
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.