Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
The equatorward bending of height contours for the 500 mb level imply the presence of a trough because this represents a region of overall lower heights. A valley and a trough are hence equivalent in the upper air flow.
A trough is a linear structural depression with lateral length that occurs in geology. A trough can be a small basin or a natural rift, albeit it is lower than a trench. At the edge of tectonic plates, these landforms frequently form.
Trough, an extended depression in the seafloor that differs from oceanic trenches in that it is shallower, shorter, narrower, and topographically more mild. The Papuan Trough's maximum depth is 2,300 m (7,500 feet), while the Banda Trough's maximum depth is 7,440 m.
Know more about trough here
brainly.com/question/13657481
#SPJ4
This change is due to an increase in earths revolution rate.(:
Good Luck!
Hi there,
the answer to your question is D. Islam.
During the 600s the Islamic religion spread towards Northern Africa.
Hope this helped :)
126,720 feet.
Why?: For each inch on a map, it’s equal to 126,720 feet in reality. All maps are not drawn to scale, so we make them smaller and add a scale to ressemble what distances are necessary.
Hope this helps.
